ID: 1163943208

View in Genome Browser
Species Human (GRCh38)
Location 19:20513824-20513846
Sequence AAGGGCCTGTTAAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163943208_1163943216 8 Left 1163943208 19:20513824-20513846 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1163943216 19:20513855-20513877 ATAATGCTCCATGCACTTGGAGG 0: 11
1: 19
2: 26
3: 38
4: 114
1163943208_1163943219 18 Left 1163943208 19:20513824-20513846 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1163943219 19:20513865-20513887 ATGCACTTGGAGGGTTAGAAAGG 0: 7
1: 12
2: 30
3: 23
4: 150
1163943208_1163943215 5 Left 1163943208 19:20513824-20513846 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1163943215 19:20513852-20513874 TATATAATGCTCCATGCACTTGG 0: 11
1: 8
2: 11
3: 17
4: 128
1163943208_1163943217 9 Left 1163943208 19:20513824-20513846 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1163943217 19:20513856-20513878 TAATGCTCCATGCACTTGGAGGG 0: 11
1: 17
2: 29
3: 36
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163943208 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr