ID: 1163943664

View in Genome Browser
Species Human (GRCh38)
Location 19:20516989-20517011
Sequence GCTCACTTACGGCCCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163943664_1163943673 30 Left 1163943664 19:20516989-20517011 CCAGTCTTGGGCCGTAAGTGAGC No data
Right 1163943673 19:20517042-20517064 ACTTCCTCTTTTGTCTACTCTGG No data
1163943664_1163943670 3 Left 1163943664 19:20516989-20517011 CCAGTCTTGGGCCGTAAGTGAGC No data
Right 1163943670 19:20517015-20517037 CAAGGGAGGAGTTTCTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163943664 Original CRISPR GCTCACTTACGGCCCAAGAC TGG (reversed) Intergenic
No off target data available for this crispr