ID: 1163957729

View in Genome Browser
Species Human (GRCh38)
Location 19:20659903-20659925
Sequence AAGACTGCTCACCCCAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163957729_1163957734 19 Left 1163957729 19:20659903-20659925 CCGTGGCTGGGGTGAGCAGTCTT 0: 1
1: 0
2: 7
3: 46
4: 252
Right 1163957734 19:20659945-20659967 CTCCCCAGAAAAAAATAACAGGG 0: 1
1: 1
2: 7
3: 45
4: 516
1163957729_1163957731 -7 Left 1163957729 19:20659903-20659925 CCGTGGCTGGGGTGAGCAGTCTT 0: 1
1: 0
2: 7
3: 46
4: 252
Right 1163957731 19:20659919-20659941 CAGTCTTGAGATATCCGCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
1163957729_1163957733 18 Left 1163957729 19:20659903-20659925 CCGTGGCTGGGGTGAGCAGTCTT 0: 1
1: 0
2: 7
3: 46
4: 252
Right 1163957733 19:20659944-20659966 ACTCCCCAGAAAAAAATAACAGG 0: 1
1: 2
2: 5
3: 36
4: 335
1163957729_1163957730 -8 Left 1163957729 19:20659903-20659925 CCGTGGCTGGGGTGAGCAGTCTT 0: 1
1: 0
2: 7
3: 46
4: 252
Right 1163957730 19:20659918-20659940 GCAGTCTTGAGATATCCGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163957729 Original CRISPR AAGACTGCTCACCCCAGCCA CGG (reversed) Intronic
903003634 1:20283998-20284020 AAGACTGGTCCCCGAAGCCAGGG + Intergenic
903218724 1:21857132-21857154 GAAACTGCCCACCCGAGCCATGG - Exonic
903266433 1:22160760-22160782 ATGCCTGCCCACCCCAGCCCAGG - Intergenic
903849927 1:26300013-26300035 AAGAAAGTTGACCCCAGCCAGGG + Intronic
904750205 1:32737221-32737243 AAGACTCCTCACTCCAGACAGGG - Intergenic
905285568 1:36877806-36877828 AAGTCAGCTCAGACCAGCCAAGG + Intronic
905642052 1:39596782-39596804 AAGCCTGCGCCCCCTAGCCATGG + Intergenic
908525029 1:64979675-64979697 AAGAGTGGCCACCCCTGCCAAGG - Intergenic
909697433 1:78483782-78483804 GAGATTGCCCTCCCCAGCCAAGG + Intronic
910092755 1:83484633-83484655 ACGCCTGCTCACCACAGGCAAGG + Intergenic
912626867 1:111212696-111212718 AAGCTTTCACACCCCAGCCAGGG - Intronic
1065457175 10:25918995-25919017 AACTCTGCTCACCCCCACCAAGG - Intergenic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067523938 10:47027259-47027281 ACCAGTGCCCACCCCAGCCAGGG + Intergenic
1069128330 10:64666587-64666609 GGGACTGCTATCCCCAGCCATGG - Intergenic
1070108573 10:73460763-73460785 GACACTGCTCCCCACAGCCAGGG + Intronic
1070172162 10:73941013-73941035 AAGACTGCTGAGCCCAGGGAGGG + Intergenic
1070184279 10:74045718-74045740 AATAATGGTCACCACAGCCAGGG + Intronic
1070208240 10:74286340-74286362 AACACTCCTCAAGCCAGCCATGG - Intronic
1073024312 10:100475596-100475618 AAGACTCTTCACCCCAGCTATGG + Intronic
1075716691 10:124559726-124559748 AGAACTGATCTCCCCAGCCATGG - Intronic
1076815752 10:132913970-132913992 ACGAGTGCTCACACCTGCCATGG + Intronic
1076869532 10:133186537-133186559 GAGACTTCACACCCCAGCCAGGG + Exonic
1077273156 11:1691203-1691225 GACACTGCTCACCCCTGGCAAGG + Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1077799965 11:5527555-5527577 CACACTGCTCTCCCCAGCCCTGG - Intronic
1078382321 11:10855339-10855361 AAGCCTGCCAACCCCTGCCATGG - Intronic
1080135830 11:28853462-28853484 AAGACTGCTTACCCAAAGCAGGG - Intergenic
1080697234 11:34613165-34613187 AAGAATGTTACCCCCAGCCAAGG + Intergenic
1081685784 11:45042100-45042122 AACACTGCTCAACCCCTCCAGGG + Intergenic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1084127688 11:67111159-67111181 AAGACTGATCACCTGAGCCTGGG + Intergenic
1088777553 11:113100282-113100304 AAAAGTGCTCACCCCAGCCCTGG - Intronic
1090031675 11:123211667-123211689 GAGACTCCACTCCCCAGCCACGG - Intergenic
1092078267 12:5691448-5691470 AAGACAGATCACTGCAGCCAGGG + Intronic
1093171085 12:15861557-15861579 CAGACTACACAACCCAGCCAAGG - Intronic
1093339165 12:17950048-17950070 ATGTCTGCTTAGCCCAGCCAAGG - Intergenic
1095084108 12:38041806-38041828 AAGACTTTGCACCCCAGCCTGGG + Intergenic
1096038268 12:48492062-48492084 AAGGCTCCTCACCCCTTCCATGG - Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1097455422 12:59793206-59793228 AGGAATCCCCACCCCAGCCAAGG - Intergenic
1099243270 12:80163683-80163705 AAGCCAAATCACCCCAGCCAAGG - Intergenic
1102117403 12:110413474-110413496 ACCACTGCTCACTCCAGCCTGGG + Intergenic
1102240471 12:111321718-111321740 AATAAAGCTCACCCTAGCCAGGG + Intronic
1102483347 12:113239260-113239282 AATCCTGCTCCCCCCAGCTAGGG + Intronic
1103647618 12:122407416-122407438 AAAACTGACCTCCCCAGCCAAGG + Intronic
1103908181 12:124337999-124338021 AACCCTGCTCCCCACAGCCAGGG + Intronic
1105728153 13:23186139-23186161 AAGGCTACTCAGACCAGCCAGGG - Intronic
1106186698 13:27415925-27415947 GTGACTGCTCACCTCTGCCAGGG + Intergenic
1109724548 13:66322304-66322326 AATACTGATCATCCCAACCACGG - Intronic
1113143048 13:107175817-107175839 AAGACTGCTAACTTCAACCAAGG - Intronic
1113202110 13:107877195-107877217 AAGATTGCTGAGCCCAGCCTAGG + Intergenic
1113976086 13:114228616-114228638 AAGACTGCTGTCCACAGACACGG - Intergenic
1114658633 14:24330988-24331010 AAGACTTCCCTCCCCACCCAGGG - Intronic
1118049408 14:62010485-62010507 AACACTCCTCACCCCACCCCAGG - Intronic
1118716405 14:68563189-68563211 AAAACTGCTCACCTCAGCCTTGG - Intronic
1122103642 14:99434371-99434393 AAGAGTGCTTACCCCTGACATGG + Intronic
1122128583 14:99592430-99592452 GAGACTGCTCAGCCCAGCCCAGG + Intronic
1122906570 14:104804313-104804335 CAGGCTGCCCACCCCAGCAAAGG - Exonic
1202903699 14_GL000194v1_random:56798-56820 ATGACTCCTGACCCCACCCACGG - Intergenic
1124055818 15:26240145-26240167 AGCACTGTTCACCACAGCCAAGG - Intergenic
1126910556 15:53412901-53412923 TTGACTGCACACCCCAGCCTGGG - Intergenic
1127464981 15:59235030-59235052 AAGCCTGCTCCCCAGAGCCATGG - Intronic
1128709088 15:69858454-69858476 GGGGCTGCTCACCCCAGCTAGGG - Intergenic
1130691285 15:86083630-86083652 TGGACTGGTCACCCCAGCCGAGG - Intergenic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1132198571 15:99932316-99932338 AAAGCTGCCCACCCAAGCCAAGG + Intergenic
1133559117 16:6933670-6933692 ATGACTGCACACTCCAGCCTGGG + Intronic
1134555695 16:15162110-15162132 AACACTCCTCACCCCTGTCAGGG - Intergenic
1134916277 16:18073821-18073843 AACACTCCTCACCCCTGTCAGGG - Intergenic
1136637792 16:31537009-31537031 AAGGCTGCCCACCCAAGGCAAGG + Intergenic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137040514 16:35607985-35608007 AAGTCACCTCACCCCAGCCTGGG - Intergenic
1137731193 16:50691793-50691815 AGGACTTCTCACTCCTGCCAGGG - Intergenic
1137768152 16:50993649-50993671 CAGACTGCTAACCACAGCTATGG - Intergenic
1139713927 16:68797611-68797633 AACACTGCTCACTGCAGCCTTGG - Intronic
1140160490 16:72486852-72486874 ACCACTGCACACTCCAGCCAGGG - Intergenic
1141266034 16:82498205-82498227 AGGACTGCTGACACCAGCCGTGG + Intergenic
1141384216 16:83604307-83604329 CAGACTGCTCACTCTTGCCATGG + Intronic
1141512940 16:84524449-84524471 AAGCCTGCTCACCAGGGCCATGG - Intronic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1142242576 16:88954327-88954349 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242598 16:88954403-88954425 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242605 16:88954422-88954444 AAGGCTCCTGACCCCATCCAAGG + Intronic
1142242616 16:88954460-88954482 AAGTGTCCTGACCCCAGCCAAGG + Intronic
1142242629 16:88954498-88954520 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242638 16:88954536-88954558 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242655 16:88954593-88954615 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242664 16:88954631-88954653 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242681 16:88954688-88954710 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242691 16:88954726-88954748 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242701 16:88954764-88954786 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242708 16:88954783-88954805 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242715 16:88954802-88954824 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242721 16:88954821-88954843 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242725 16:88954840-88954862 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242732 16:88954859-88954881 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242742 16:88954897-88954919 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242749 16:88954916-88954938 AAGGCTCCTGACCCCATCCAAGG + Intronic
1142242755 16:88954935-88954957 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242761 16:88954954-88954976 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242774 16:88954992-88955014 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242783 16:88955030-88955052 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242793 16:88955068-88955090 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242803 16:88955106-88955128 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242810 16:88955125-88955147 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242817 16:88955144-88955166 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242823 16:88955163-88955185 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242827 16:88955182-88955204 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242834 16:88955201-88955223 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242844 16:88955239-88955261 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242851 16:88955258-88955280 AAGGCTCCTGACCCCATCCAAGG + Intronic
1142242857 16:88955277-88955299 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242863 16:88955296-88955318 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242886 16:88955372-88955394 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142242896 16:88955410-88955432 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242906 16:88955448-88955470 AAGACTCCTGACCCCACCCAAGG + Intronic
1142242913 16:88955467-88955489 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242920 16:88955486-88955508 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242926 16:88955505-88955527 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242933 16:88955524-88955546 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242940 16:88955543-88955565 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242946 16:88955562-88955584 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242953 16:88955581-88955603 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242960 16:88955600-88955622 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242973 16:88955638-88955660 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242985 16:88955676-88955698 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242992 16:88955695-88955717 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142242999 16:88955714-88955736 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142243003 16:88955733-88955755 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243010 16:88955752-88955774 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243017 16:88955771-88955793 AAGGCTCCTGACCTCAGCCAAGG + Intronic
1142243021 16:88955790-88955812 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243038 16:88955847-88955869 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142243057 16:88955904-88955926 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243070 16:88955942-88955964 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243083 16:88955980-88956002 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243089 16:88955999-88956021 AAGGCTCCTGACCCCACCCAAGG + Intronic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1142961008 17:3552640-3552662 AAGCCTCCTCCGCCCAGCCAAGG - Intronic
1142986898 17:3700912-3700934 AACTCCCCTCACCCCAGCCAGGG + Intergenic
1146719655 17:35114972-35114994 CAGACTGATCTCCACAGCCAAGG - Intronic
1147443463 17:40461274-40461296 AAGTCTGCCCTCCCCATCCAGGG - Intergenic
1148460530 17:47836882-47836904 AGGGCTGCTGTCCCCAGCCATGG - Exonic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1151940568 17:77288982-77289004 ATGACTCATCGCCCCAGCCAAGG - Intronic
1152487534 17:80603970-80603992 AAGTCCGCAGACCCCAGCCACGG + Intronic
1153958040 18:10114980-10115002 CAGACTGCTCTGGCCAGCCAGGG + Intergenic
1155434005 18:25792365-25792387 AAGACTGCTTTTCCCTGCCATGG + Intergenic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1156373260 18:36490104-36490126 TGAACTGCTCACCCAAGCCATGG - Intronic
1157491675 18:48127942-48127964 GAGGCTGCCCAGCCCAGCCAAGG + Intronic
1160949895 19:1661009-1661031 ACCACTGCTCACCCATGCCAAGG + Intergenic
1161460060 19:4391215-4391237 GACACTGCTCACCCCACCCCTGG - Intronic
1162025635 19:7892501-7892523 AAGAATGCTGACCCCAGGCTGGG - Intronic
1163687851 19:18722235-18722257 AGGTCTCCTCTCCCCAGCCAAGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164720628 19:30429187-30429209 ATGACTCCTCTCCCCAGCCCAGG - Intronic
1167722840 19:51190662-51190684 AAGCATCCTCCCCCCAGCCATGG + Intergenic
926136825 2:10342485-10342507 AGGACTGATCAGCCCAGCCTGGG + Intronic
927146864 2:20171916-20171938 AAGCCTGCTGAGCCCAGCCTGGG + Intergenic
927970722 2:27304888-27304910 TACACCCCTCACCCCAGCCAGGG - Intronic
932168471 2:69531128-69531150 TCCACTCCTCACCCCAGCCAGGG - Intronic
933846160 2:86328816-86328838 AAAAGTGCTCACCCCAGCCCTGG - Intronic
934698890 2:96422819-96422841 ATGATTGCTCACTCCAGCCTAGG - Intergenic
935555885 2:104508953-104508975 TAGGCTGCTCTCTCCAGCCAGGG + Intergenic
936044613 2:109176990-109177012 AAGCCTGCTCACCCCAGTGCAGG - Intronic
936849169 2:116874430-116874452 GAGTCTTCTCACCCCAGCTAGGG - Intergenic
938034038 2:128020945-128020967 AAGACTGTGCACTCCAGCCTGGG + Intronic
940799273 2:158115528-158115550 AACACCCCTCACCCCCGCCACGG + Intronic
941047108 2:160689025-160689047 AAGACTGCTGAACCCACTCATGG + Intergenic
941506450 2:166351620-166351642 AAGACTGATGAATCCAGCCAGGG - Intronic
941663270 2:168217028-168217050 AAGACTGCTCAGACCTGCCAGGG + Intronic
946600567 2:221355773-221355795 AAGACTGCTCCTCCCATCCCCGG + Intergenic
947080706 2:226392670-226392692 ACTGCTGCTCATCCCAGCCAGGG + Intergenic
948301163 2:236908583-236908605 AAGACTGGCCAGTCCAGCCAAGG + Intergenic
1169019767 20:2320951-2320973 GAGACTGCCCAGCCCTGCCAGGG + Intronic
1171360996 20:24586253-24586275 AAAACTGCTCAGCCTAGCCCCGG - Intronic
1172697428 20:36832254-36832276 AGGAGCCCTCACCCCAGCCAGGG - Intronic
1172896650 20:38304837-38304859 CAGACCACTCACCCCAGCCCAGG + Intronic
1173930437 20:46813342-46813364 AAGAGTGCTCACCGCAGCATGGG - Intergenic
1175586317 20:60143207-60143229 AAGACTGGTCACTGCAGCCTTGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176623061 21:9071567-9071589 ATGACTCCTGACCCCACCCACGG - Intergenic
1180594859 22:16966485-16966507 AAGACAGCAGCCCCCAGCCAAGG - Intronic
1180825627 22:18858945-18858967 CAGGCTGCTCACCCCAGGCCTGG - Intronic
1180920748 22:19520292-19520314 AGGACAGCTCAGCCCAGTCAAGG + Intronic
1184091473 22:42295152-42295174 AAGCCTCCTAACCCCAGCCTGGG + Intronic
1184328848 22:43812680-43812702 ATGACTGCTCACCCTAACGAAGG - Intergenic
1184926279 22:47642057-47642079 AAGCCTGCTCGCTCTAGCCAAGG + Intergenic
1203214860 22_KI270731v1_random:541-563 CAGGCTGCTCACCCCAGGCCTGG + Intergenic
949145076 3:690572-690594 AGGACTGCCTACCCTAGCCATGG + Intergenic
949497373 3:4645301-4645323 CAGACTTCTCACCGCAGCCTAGG - Intronic
949845604 3:8367397-8367419 GAGAAGGCTCAGCCCAGCCATGG - Intergenic
950177620 3:10886306-10886328 AAGACTGCTCCCCGTGGCCATGG + Intronic
950262871 3:11554909-11554931 AGGACTGCTGACCCCAGGCCTGG + Exonic
950568739 3:13787243-13787265 AAGAGAGACCACCCCAGCCACGG - Intergenic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
953918353 3:46935058-46935080 GAGACTTCCCACCCCAGCTAAGG - Intronic
954936343 3:54330513-54330535 AAGACTGCTAACCCTAACCCAGG + Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
961061699 3:123834084-123834106 ACCACTGCACACCCCAGCCTGGG - Intronic
961822562 3:129582597-129582619 AGGCCTTATCACCCCAGCCAAGG + Intronic
963323234 3:143832650-143832672 AACACCTCTCACCCCAACCATGG - Intronic
963403084 3:144826450-144826472 AAACCTGGCCACCCCAGCCATGG - Intergenic
966944409 3:184767705-184767727 AAGACGGCTCCCTTCAGCCAAGG + Intergenic
967270162 3:187726474-187726496 AACACTTCTGACCCCAGCAAAGG + Intronic
968224845 3:196967174-196967196 AACACTGCTCCCGCCAGCCGCGG + Intronic
968727275 4:2253615-2253637 AACACTGAGCACCCCAGCCTTGG + Intronic
969159951 4:5247973-5247995 AAGTCTGCTCAGGGCAGCCATGG + Intronic
969540028 4:7782597-7782619 AAAACTGATAACCACAGCCAGGG + Intronic
970005717 4:11408904-11408926 ATGACTGTCCACCCCAGCCAGGG - Intronic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
977060800 4:92254993-92255015 AAAACTGAGCACCCCAGGCAAGG - Intergenic
982217457 4:153094769-153094791 AGGACTGTCCACCTCAGCCAGGG - Intergenic
982725782 4:158904179-158904201 AAGTCTGGTGACCCCTGCCAAGG + Intronic
983819394 4:172173832-172173854 AAGCTTGATCACCCCAGCAATGG + Intronic
984081880 4:175257309-175257331 AAGAAAGCTCACCCAAGCCTTGG + Intergenic
984925399 4:184802298-184802320 AAAAATGCTGACTCCAGCCAGGG + Intronic
987586110 5:19859132-19859154 ATGGATGCTCACCTCAGCCAAGG + Intronic
988106284 5:26753339-26753361 AAGATTGCGCACTCCAGTCAGGG - Intergenic
988891150 5:35618245-35618267 CCTACAGCTCACCCCAGCCAGGG + Intronic
991001853 5:61790976-61790998 AACACTGCTCAGCTGAGCCATGG + Intergenic
1000220227 5:159208439-159208461 AATACTGCTTTCCCCACCCAAGG - Intronic
1002345312 5:178544440-178544462 GAGACTGCTCCCCACCGCCATGG - Intronic
1002439813 5:179258458-179258480 AAGCCTGGCCACCCCAGCCTCGG + Intronic
1004363831 6:14995468-14995490 AACACTGCACAGCCCAGGCAAGG + Intergenic
1006449458 6:34097784-34097806 AAGACTGTTCAGCTCAGTCAGGG + Intronic
1006915232 6:37589673-37589695 CAGTCTGATCACCCCAGCTAAGG + Intergenic
1015147218 6:130000576-130000598 AGGACTGCTTATTCCAGCCAAGG - Intergenic
1020004936 7:4777724-4777746 ACGGCTGCCCACCCGAGCCAGGG - Intronic
1020050431 7:5077783-5077805 AAGACTGCCCAGCCCATCCTGGG - Intergenic
1021574683 7:22096384-22096406 AGGGCAGCTCACCCAAGCCATGG - Intergenic
1023827168 7:44017365-44017387 AGGACTGCACACTCCAGCCAGGG - Intergenic
1023834794 7:44061825-44061847 GAGGGTGCTCACCCCAGACACGG - Intronic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1026289561 7:68994166-68994188 ATGCCGGCTCACCCCAGGCATGG + Intergenic
1027309615 7:76941129-76941151 ACGCCTGCTCACCACAGGCAAGG + Intergenic
1027856271 7:83515640-83515662 TAGACTGCTCACCTCAGCAATGG + Intronic
1029279864 7:99428690-99428712 AAGATCGCTCACTCCAGCCTGGG + Intronic
1029738320 7:102477111-102477133 AGGACTGCACACTCCAGCCAGGG - Intronic
1029755450 7:102570767-102570789 AGGACTGCACACTCCAGCCAGGG - Intronic
1029773399 7:102669847-102669869 AGGACTGCACACTCCAGCCAGGG - Intronic
1037293893 8:17380711-17380733 ACAAGTGCTCACCACAGCCATGG - Intronic
1037873331 8:22521092-22521114 GAGACAGCTCTCCCCATCCATGG - Intronic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1041764479 8:61404064-61404086 AAGAATCCTCACTCCAGGCAGGG - Intronic
1045525011 8:102934023-102934045 AAGACAGCTCCCTTCAGCCAAGG + Intronic
1049022867 8:139969746-139969768 AAAAATGCTCTCCCCTGCCATGG + Intronic
1051362306 9:16291986-16292008 AATATTGCCCACCACAGCCAGGG + Intergenic
1051497638 9:17742538-17742560 AAGACTGCTCACCTCACTCTGGG - Intronic
1052855668 9:33404735-33404757 TAGACTCCTCTCCCCAGCCCAGG - Intergenic
1053283852 9:36838234-36838256 AAGCCTGGTCACCCAGGCCAGGG - Exonic
1053466341 9:38311436-38311458 AAGGCTGCTCACAGGAGCCAGGG - Intergenic
1055494484 9:76841139-76841161 GGGACTGGTCAGCCCAGCCATGG + Intronic
1056304658 9:85278000-85278022 AGGACTACACACTCCAGCCAGGG - Intergenic
1057557204 9:96097623-96097645 AAGACAGATCAGCCCAGCCCAGG - Intergenic
1057840263 9:98480657-98480679 AAGTCTGCTCAACTTAGCCAGGG - Intronic
1059116016 9:111600275-111600297 AAGAGTGCTCACTCCTGCCTGGG - Intergenic
1059669230 9:116477392-116477414 AGGACTGGACACCACAGCCAAGG + Intronic
1062492759 9:136815193-136815215 AAGAAGGGACACCCCAGCCAAGG - Intronic
1062589758 9:137268220-137268242 AAGACAGCAAACCCCAGACAAGG - Intronic
1203746250 Un_GL000218v1:41994-42016 ATGACTCCTGACCCCACCCACGG - Intergenic
1203563852 Un_KI270744v1:77487-77509 ATGACTCCTGACCCCACCCACGG + Intergenic
1187205653 X:17178605-17178627 AAGACATCTCACCACAGACAGGG + Intergenic
1189043451 X:37567250-37567272 AAGACAGCAAAACCCAGCCATGG + Intronic
1189074894 X:37905320-37905342 CCTACTGCTCACCACAGCCAAGG - Intronic
1189571791 X:42306382-42306404 AAGCCCCCTCCCCCCAGCCAAGG + Intergenic
1189932791 X:46032905-46032927 GAGACTGCTCTCCTCAACCAAGG - Intergenic
1190592163 X:52014955-52014977 AAGCCTCCTGAACCCAGCCAAGG - Intergenic
1191223652 X:58017073-58017095 AAGAGTGGTCACTCCACCCATGG + Intergenic
1191775294 X:64807509-64807531 GAGAGTCCTCACCCCAGCCAAGG + Intergenic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1201159580 Y:11157007-11157029 ATGACTCCTGACCCCACCCACGG - Intergenic