ID: 1163967306

View in Genome Browser
Species Human (GRCh38)
Location 19:20758785-20758807
Sequence CTACAAACCCCCAAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163967305_1163967306 -3 Left 1163967305 19:20758765-20758787 CCAGGTGGGCACAGTTGAAACTA 0: 1
1: 1
2: 0
3: 8
4: 116
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1163967303_1163967306 7 Left 1163967303 19:20758755-20758777 CCCATGAACTCCAGGTGGGCACA 0: 2
1: 0
2: 2
3: 18
4: 182
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1163967297_1163967306 25 Left 1163967297 19:20758737-20758759 CCAGCCATCATTGTCAGCCCCAT 0: 1
1: 1
2: 0
3: 16
4: 231
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1163967298_1163967306 21 Left 1163967298 19:20758741-20758763 CCATCATTGTCAGCCCCATGAAC 0: 1
1: 1
2: 2
3: 14
4: 164
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1163967302_1163967306 8 Left 1163967302 19:20758754-20758776 CCCCATGAACTCCAGGTGGGCAC 0: 2
1: 0
2: 1
3: 14
4: 133
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167
1163967304_1163967306 6 Left 1163967304 19:20758756-20758778 CCATGAACTCCAGGTGGGCACAG 0: 2
1: 0
2: 6
3: 35
4: 248
Right 1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163967306 Original CRISPR CTACAAACCCCCAAATATAT TGG Intronic
904929562 1:34075656-34075678 CTATAAACCCTCCAATATACGGG + Intronic
905120700 1:35679629-35679651 CTTCAAACCCCCACATCTCTAGG + Intergenic
906359440 1:45140338-45140360 CTACAAAACCTAAAATATTTAGG + Intronic
906619800 1:47266908-47266930 CTACAAAGCCCCATATAACTTGG + Intronic
908649034 1:66311960-66311982 GTATAAATCCCCAAATGTATAGG + Intronic
913392354 1:118328418-118328440 ATAAAAACCCCAACATATATAGG - Intergenic
918554731 1:185784664-185784686 GTAGAAACCCCCCAATAAATAGG - Intronic
918923436 1:190746642-190746664 CTAAAAACCCTAAAACATATGGG - Intergenic
1064803561 10:19104674-19104696 CTTAAAACCCTGAAATATATGGG - Intronic
1066512573 10:36118020-36118042 TTACATTCCCCCAAATTTATCGG - Intergenic
1068515943 10:58025488-58025510 CTAGTAACCCCCAAAGATAGGGG - Intergenic
1073664570 10:105516292-105516314 CTAAGATCCCCCAAATGTATTGG + Intergenic
1073821707 10:107271867-107271889 CTACAGAGCCCCAAACCTATGGG + Intergenic
1078322249 11:10346774-10346796 CTATACACCCCCAAATGAATAGG + Intronic
1079829440 11:25244224-25244246 CTACAAACAAGGAAATATATGGG + Intergenic
1080683915 11:34499962-34499984 CAACAAACCTCCTAAGATATAGG - Intronic
1092852596 12:12644195-12644217 CTCCAAAACACCAAATAAATAGG - Exonic
1096316007 12:50566501-50566523 CTGCAAACTTCCAAATTTATTGG - Intronic
1097487401 12:60222297-60222319 CTAGAAACCTCCAAATATTCTGG + Intergenic
1097930270 12:65175965-65175987 CTACAAACCCCCAACCTAATTGG + Intronic
1098188080 12:67919730-67919752 CTACATACCTCCCAATATTTAGG - Intergenic
1098245974 12:68518249-68518271 CTTCAGCCCCCCAAATAGATGGG + Intergenic
1098602511 12:72348750-72348772 CTACATACCCAGAAATATGTTGG + Intronic
1099276962 12:80589073-80589095 ATACAAACCACTAAATGTATAGG + Intronic
1100133964 12:91531633-91531655 ATACATACACCCATATATATGGG + Intergenic
1103484024 12:121270624-121270646 AAACAAAACCCCAAATGTATTGG + Intronic
1104129646 12:125880946-125880968 CTACACACCCCCAGATGTTTTGG - Intergenic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1108162146 13:47651913-47651935 CTAATAACGCCCAAATCTATTGG + Intergenic
1109279206 13:60336629-60336651 CTATAAAACCTCAAATACATGGG - Intergenic
1110159200 13:72354902-72354924 CTACAAACCAAGAGATATATAGG - Intergenic
1110875298 13:80502266-80502288 CTACATACCTACACATATATAGG - Intergenic
1114786929 14:25611175-25611197 GTATAAACTCCCATATATATGGG + Intergenic
1115783121 14:36793151-36793173 CTACAAACAGGCAAAAATATGGG + Intronic
1118525846 14:66641571-66641593 GGACAAATCCCCAAATATACTGG + Intronic
1118714908 14:68552329-68552351 CTACACACCCTGCAATATATGGG - Intronic
1123099464 14:105786648-105786670 CTGCTAACCCCCAAATCTCTAGG - Intergenic
1124985900 15:34613117-34613139 CTACAAAGACCCAAATACAATGG + Intergenic
1130671381 15:85915992-85916014 CAAAAAACTCCCAAATAAATTGG + Intergenic
1130681441 15:86000506-86000528 CTAGGAATCCCCAAATTTATAGG - Intergenic
1132129698 15:99264585-99264607 ATGCAAACCCCCACATAGATGGG + Intronic
1133828011 16:9296143-9296165 GTACAAAAGCGCAAATATATCGG + Intergenic
1135178702 16:20254231-20254253 CTACACACCCCCAAAGATGTAGG + Intergenic
1137065466 16:35837215-35837237 CTACAAGCTCCCAAGTACATTGG + Intergenic
1139032334 16:62900288-62900310 CTATAATCCCCCAAAATTATGGG + Intergenic
1139759370 16:69172078-69172100 CTAAAAACCCCCAAATTTGATGG - Intronic
1140293289 16:73684555-73684577 CTCAAAACCCACAAATATGTTGG + Intergenic
1141767613 16:86069064-86069086 CTCCAAACCCCCAAATCCTTGGG - Intergenic
1144136973 17:12304721-12304743 CAATAAACCCCCAAATATTTGGG - Intergenic
1144378167 17:14666230-14666252 CTACCAACCTTCAAATAAATCGG + Intergenic
1146971800 17:37078979-37079001 CTATAAACCCCAAAATACAGTGG + Intergenic
1148528459 17:48365704-48365726 CTTCACACCACCAAATATAAGGG + Intronic
1150302599 17:64058882-64058904 CTACAAACCCCCAAAAATGTGGG - Intronic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1154404397 18:14075357-14075379 CTACAAGCTCCCAAATAGAATGG - Intronic
1155735534 18:29218235-29218257 CTACAAAACCTAAAATATTTAGG + Intergenic
1155765950 18:29632980-29633002 CAACAAAACCAAAAATATATAGG - Intergenic
1156714055 18:39984643-39984665 TAAAAAAGCCCCAAATATATGGG + Intergenic
1157180900 18:45497111-45497133 ATACACACTCCCATATATATGGG - Intronic
1158193009 18:54852262-54852284 CTACAAATCCCTACTTATATAGG + Intronic
1159781403 18:72664688-72664710 CTACAAATCTCCACATATAGAGG - Intergenic
1163887411 19:19978912-19978934 CTACAAGCTCCCAAATACATTGG - Intergenic
1163950785 19:20583276-20583298 CTACAAGCTCCCAAATACATTGG - Intronic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1164250678 19:23471978-23472000 GAAAAAACCCTCAAATATATGGG - Intergenic
1164291762 19:23876036-23876058 GAAAAAACCCTCAAATATATGGG + Intergenic
1164301990 19:23971132-23971154 GAAAAAACCCTCAAATATATGGG + Intergenic
1164397089 19:27875711-27875733 CTACACACCCCTAGATATTTTGG + Intergenic
1165933845 19:39377320-39377342 CTGCAAGCCCACAAACATATAGG - Intronic
1166887042 19:45968007-45968029 CTACAACACCCCAAATCTCTTGG - Intronic
1166942956 19:46378288-46378310 CTAGAAGTCCCCAAATATTTGGG - Intronic
1167447606 19:49547418-49547440 ATACAAAACCCGAAATATACAGG + Intergenic
925725591 2:6867567-6867589 CTATAACCCCCCACATATCTGGG + Intronic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
929202583 2:39252863-39252885 AGGCAAACCCCAAAATATATTGG - Intronic
933372417 2:81432260-81432282 CTCCAAATCCCCGAAGATATTGG - Intergenic
935506117 2:103905709-103905731 AAATAAACCCACAAATATATAGG - Intergenic
935939648 2:108224792-108224814 TTATAAATTCCCAAATATATAGG + Intergenic
937364359 2:121249971-121249993 TTACAAACCCCCCAATACAACGG + Intronic
938153998 2:128912802-128912824 GTACAAACACGCAAATATAAGGG + Intergenic
944363432 2:198887001-198887023 CTATAAAGCCTAAAATATATAGG - Intergenic
944718515 2:202399480-202399502 CTACAAATCCCCAAATGATTTGG - Intronic
945665066 2:212730856-212730878 CTATAAAACCTCAAATATAAAGG + Intergenic
947092951 2:226533381-226533403 CTACAAAATCCTAAATATAATGG - Intergenic
1173071886 20:39776041-39776063 CTATAAACCCCCATAAATAATGG - Intergenic
1177499648 21:21936606-21936628 CTACAAACCAACAAATACAAAGG + Intergenic
949106624 3:207111-207133 CTTAAAACTCCCAAATATATTGG - Intronic
949707645 3:6837389-6837411 CTGCAAACCCAAAAATATGTTGG - Intronic
950070467 3:10148116-10148138 CAAAAACCCCCCAAATACATGGG + Intronic
950247626 3:11436078-11436100 CAACAAAACCCAGAATATATAGG + Intronic
950472390 3:13194201-13194223 TTACACACCCCCAAATTCATAGG - Intergenic
952081575 3:29764763-29764785 CTACAAATCCCCAAATGTCTGGG + Intronic
952180272 3:30909830-30909852 TTAGAAACCCCCAAATAATTCGG + Intergenic
954489146 3:50885200-50885222 CTACAAAGCCACAAAAACATGGG - Intronic
956081366 3:65560092-65560114 ATACAAAACTCCATATATATAGG + Intronic
956814752 3:72898000-72898022 ATACACACACCCACATATATTGG + Intronic
957144551 3:76406957-76406979 CTACAAAACCCCACATAAACTGG + Intronic
958604105 3:96336519-96336541 CTAGAAACCCCAAGTTATATTGG + Intergenic
962459983 3:135602191-135602213 TTACAAAACCCCCAAAATATTGG - Intergenic
965245432 3:166260971-166260993 CTACAACTCCCCAAAGTTATTGG + Intergenic
966559451 3:181303480-181303502 AGACAAAACCCCAAATAAATAGG + Intergenic
972000162 4:34021637-34021659 CTATGAAACTCCAAATATATTGG - Intergenic
972488152 4:39561817-39561839 CTACAACCCCCCAAGTAGCTGGG - Intronic
973248129 4:48032131-48032153 CTACATCCCCCCAAATCTATAGG - Intronic
974293554 4:59965277-59965299 ATACAAACCACAAAAAATATTGG - Intergenic
974498722 4:62667963-62667985 CTCCTATCCCCCAAATTTATAGG - Intergenic
974572983 4:63678898-63678920 CCATAAACCCTGAAATATATAGG - Intergenic
974965271 4:68752471-68752493 CTACAAACCACAAGATATTTGGG + Intergenic
975231816 4:71944532-71944554 TTTCAAAGCCCCAAAGATATCGG + Intergenic
975488356 4:74960368-74960390 CTAAAAACAACCACATATATGGG + Intronic
975954346 4:79820271-79820293 CTACAAACCACAAAATATAATGG + Intergenic
977026943 4:91831730-91831752 CTAAAAATTCTCAAATATATGGG + Intergenic
977256740 4:94749294-94749316 CTATAGACTCCCAACTATATTGG - Intergenic
978311542 4:107389348-107389370 ATGCAAAACACCAAATATATGGG - Intergenic
979088636 4:116449445-116449467 CTACAATCACACACATATATAGG + Intergenic
980737984 4:136916235-136916257 ATACAAGCCCCAAAATAAATAGG + Intergenic
983432326 4:167666550-167666572 CTTCAAACTTCCAAATGTATTGG - Intergenic
984151474 4:176138305-176138327 TTTTAAAACCCCAAATATATAGG - Intronic
984260657 4:177441058-177441080 CCCCACACCCCCAAATGTATGGG - Intronic
984454934 4:179953654-179953676 CTGCAAGCAACCAAATATATGGG - Intergenic
986796496 5:11217848-11217870 CAACAAACACCCAAAGAGATTGG - Intronic
988818075 5:34853755-34853777 CTACCAACCGCCAAATCCATGGG - Intronic
989959841 5:50399488-50399510 GTTTATACCCCCAAATATATGGG + Intronic
991285302 5:64968228-64968250 CTCCATATCTCCAAATATATCGG - Intronic
992315143 5:75544685-75544707 TGACAAACCCAGAAATATATGGG + Intronic
993823241 5:92647007-92647029 CTACAAACCCCTAAATTACTTGG - Intergenic
994938007 5:106281141-106281163 CTACAATCTCCCAAGTAGATGGG + Intergenic
996038386 5:118783546-118783568 ATATAAACCCACAAATAAATGGG - Intergenic
996268903 5:121578706-121578728 CTACAGCCACTCAAATATATGGG - Intergenic
997677295 5:135722408-135722430 CTACAAACACACAAATTCATAGG - Intergenic
999979484 5:156944257-156944279 CTACAAAACCCCAAATGGCTAGG - Intronic
1003425076 6:5993794-5993816 CTGCAAACCCCCAACTAGAGTGG - Intergenic
1004547855 6:16615915-16615937 CCACAGACTCCCAAATATCTGGG - Intronic
1004778464 6:18876080-18876102 CCTCAAACTCCCAAATATCTGGG + Intergenic
1007134359 6:39507311-39507333 CTTCTAACCCCCAAATATGTGGG - Intronic
1007739047 6:44000126-44000148 CTACAGACCCCCAAACATGCAGG - Intergenic
1007764140 6:44151075-44151097 CTACACATACCCAAAAATATGGG - Intronic
1008209425 6:48702645-48702667 CTAAATAGCCCCAAATGTATTGG - Intergenic
1008347506 6:50446205-50446227 AAACAAACCCCCAAATCTTTGGG - Intergenic
1008348806 6:50463557-50463579 CTAAAACCCCTCAAAAATATTGG + Intergenic
1009729767 6:67585570-67585592 CTACAAACCCCCCAAAATTCTGG - Intergenic
1011669372 6:89667880-89667902 CTACAGAGCCCTAGATATATTGG - Intronic
1012117439 6:95320384-95320406 CTACAAACCAAGAAATATAATGG - Intergenic
1012652895 6:101779771-101779793 ACACATACCCCCATATATATGGG - Intronic
1012673194 6:102082628-102082650 GTACATACCCTCAAATATTTGGG + Intergenic
1013715252 6:112952966-112952988 CCAAAAAACCCCAAATATCTAGG - Intergenic
1014362011 6:120489901-120489923 CTATAATCCCCCAAATGTAGTGG + Intergenic
1016301503 6:142636671-142636693 CAAAAAACCCCCAAAAATATGGG - Intergenic
1016491320 6:144606996-144607018 TTACAAACCAGCAAATAAATGGG - Intronic
1017484127 6:154887348-154887370 AAACAAACCCCCAAATAGATGGG - Intronic
1017735806 6:157362097-157362119 CCACAAACCACCAAATTTAAGGG - Intergenic
1021344037 7:19501147-19501169 TTAGAAACCCCCAAATGAATAGG + Intergenic
1029909304 7:104128077-104128099 CTAGAAACACCCAAATTTATGGG + Intronic
1035488210 7:159247275-159247297 CTAGAAAACCCAAAATATAGTGG + Intergenic
1037073972 8:14689517-14689539 CTAAAAATTCCCAAATATATTGG - Intronic
1039726154 8:40218826-40218848 CTAAAATCCCTCAAATATTTCGG + Intergenic
1041350887 8:56946837-56946859 CCACAGACCCCAAAATATGTGGG - Intergenic
1043421858 8:80106077-80106099 CTAAAAACCCACAAAAAAATAGG - Intronic
1043852918 8:85234859-85234881 CCCCAAACCCCCAAATTTAAAGG + Intronic
1043987625 8:86712839-86712861 CTACAAACTCCCAAGTAGCTAGG + Intronic
1046894957 8:119462770-119462792 CTACAAAATCTCCAATATATTGG + Intergenic
1050555937 9:6789729-6789751 GTACATACCCCCAAATTCATGGG - Intronic
1055844779 9:80548344-80548366 ATACAAACCCTAAAATATATAGG + Intergenic
1057409253 9:94802292-94802314 CTAAAAACTCCCAAGTAAATAGG - Intronic
1059088368 9:111329445-111329467 TTACAAACTCACAAAGATATGGG - Intergenic
1186164863 X:6815919-6815941 ATATAAAGCCCCATATATATGGG - Intergenic
1187357169 X:18587314-18587336 CTATAAACCCCTAAATAAACTGG + Intronic
1189178198 X:38979132-38979154 CTACAAACCCATGAATACATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190596382 X:52055509-52055531 TTACAAACCCCCGTATATGTTGG - Intergenic
1190612442 X:52198564-52198586 TTACAAACCCCCGTATATGTTGG + Intergenic
1190822033 X:53982635-53982657 AAACAAATCCCCATATATATGGG + Intronic
1192090100 X:68145313-68145335 TTGAAAACCTCCAAATATATGGG + Intronic
1193352149 X:80475868-80475890 TAAAAAACCCCAAAATATATGGG - Intergenic
1193476746 X:81975511-81975533 CTATTAACCTTCAAATATATTGG - Intergenic
1195428805 X:104764736-104764758 ATAAAAACCCCCAAAAAAATGGG - Intronic
1195501559 X:105606936-105606958 ATACAAACCTACAACTATATAGG + Intronic
1195928202 X:110047479-110047501 CCACAAAACCCCAAATATGTTGG - Intronic
1196487611 X:116231884-116231906 CTATAAACTCCGAAAAATATTGG - Intergenic
1197954976 X:131936678-131936700 CTAGAAGCCCCCAAATAGTTTGG + Intergenic
1198624665 X:138557125-138557147 CTATAAACCCCCAACCAAATAGG + Intergenic
1199490306 X:148390771-148390793 CAAAACATCCCCAAATATATAGG + Intergenic
1199995766 X:153025090-153025112 CTCCAAACCCACAAAGAAATGGG - Intergenic
1201558988 Y:15295026-15295048 TTATAAAGCCCCATATATATGGG + Intergenic
1201558991 Y:15295035-15295057 TTATAAAGCCCCATATATATGGG - Intergenic