ID: 1163969562

View in Genome Browser
Species Human (GRCh38)
Location 19:20779035-20779057
Sequence CAGGATAAAGGCTCCTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163969562_1163969566 6 Left 1163969562 19:20779035-20779057 CCATAGAAGGAGCCTTTATCCTG No data
Right 1163969566 19:20779064-20779086 GCTACAGAGCCCTGGAAAGCTGG 0: 18
1: 15
2: 15
3: 35
4: 287
1163969562_1163969571 17 Left 1163969562 19:20779035-20779057 CCATAGAAGGAGCCTTTATCCTG No data
Right 1163969571 19:20779075-20779097 CTGGAAAGCTGGGGTCCCACAGG 0: 1
1: 14
2: 18
3: 36
4: 266
1163969562_1163969567 7 Left 1163969562 19:20779035-20779057 CCATAGAAGGAGCCTTTATCCTG No data
Right 1163969567 19:20779065-20779087 CTACAGAGCCCTGGAAAGCTGGG No data
1163969562_1163969568 8 Left 1163969562 19:20779035-20779057 CCATAGAAGGAGCCTTTATCCTG No data
Right 1163969568 19:20779066-20779088 TACAGAGCCCTGGAAAGCTGGGG 0: 12
1: 15
2: 14
3: 41
4: 338
1163969562_1163969565 -2 Left 1163969562 19:20779035-20779057 CCATAGAAGGAGCCTTTATCCTG No data
Right 1163969565 19:20779056-20779078 TGAGAGAAGCTACAGAGCCCTGG 0: 17
1: 13
2: 14
3: 40
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163969562 Original CRISPR CAGGATAAAGGCTCCTTCTA TGG (reversed) Intronic
No off target data available for this crispr