ID: 1163970518

View in Genome Browser
Species Human (GRCh38)
Location 19:20789301-20789323
Sequence GGTATAGTCAGACCAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163970518_1163970523 28 Left 1163970518 19:20789301-20789323 CCTTATTTTGGTCTGACTATACC 0: 1
1: 0
2: 3
3: 6
4: 129
Right 1163970523 19:20789352-20789374 GAAGAGATCAGAGTTTTGGCTGG 0: 8
1: 8
2: 7
3: 24
4: 282
1163970518_1163970522 24 Left 1163970518 19:20789301-20789323 CCTTATTTTGGTCTGACTATACC 0: 1
1: 0
2: 3
3: 6
4: 129
Right 1163970522 19:20789348-20789370 ATTAGAAGAGATCAGAGTTTTGG 0: 8
1: 11
2: 7
3: 34
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163970518 Original CRISPR GGTATAGTCAGACCAAAATA AGG (reversed) Intronic
909359736 1:74746371-74746393 GGTATAATGAGACTAAAATAAGG - Intronic
909908704 1:81233092-81233114 GGTGTTGACAGACAAAAATAGGG + Intergenic
911462039 1:98203306-98203328 TGTTTAGTCAGAACAAAATATGG + Intergenic
912165875 1:107041431-107041453 GGGACATTCAAACCAAAATAGGG - Intergenic
912789214 1:112635220-112635242 GATTTAGACAGACCAAGATAGGG + Intronic
913957988 1:143320917-143320939 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
914052298 1:144146275-144146297 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
914126899 1:144820266-144820288 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
915696055 1:157743226-157743248 AGAATGGACAGACCAAAATAAGG + Intergenic
918461587 1:184782509-184782531 GGTAACTTCAGACCAAATTAAGG - Intergenic
919871079 1:201822014-201822036 GGTATATTAAGTCCAAAAGATGG + Exonic
920975166 1:210779020-210779042 GGTGTATTCCGACCACAATATGG - Intronic
923017974 1:230141627-230141649 GGAATATTCAGCCCTAAATAGGG - Intronic
1063728808 10:8671887-8671909 GGTATTGTAAGACAGAAATAAGG - Intergenic
1064988842 10:21238096-21238118 GGTAAAATCAGACCAGAACAAGG - Intergenic
1066759693 10:38739677-38739699 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1066961930 10:42233085-42233107 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1070514581 10:77192415-77192437 GGTATAGCAAAAGCAAAATACGG + Intronic
1070790627 10:79187238-79187260 GCTGTAGTCACACCACAATATGG + Intronic
1073735261 10:106337737-106337759 GATAAATTAAGACCAAAATATGG - Intergenic
1075533559 10:123251104-123251126 GATATAGTCAAATCAAAATGCGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1084351224 11:68601211-68601233 GTTATAAACAGACCAAAAAAAGG - Intronic
1086304136 11:85461471-85461493 AGCATAGTCAGACTCAAATATGG - Intronic
1087251541 11:95905812-95905834 GATATATTCACACTAAAATAAGG + Intronic
1092063961 12:5574092-5574114 GGTATTGTGGGACCAACATAGGG - Intronic
1094047698 12:26185495-26185517 GGTATAATCAGACCAGTACAAGG - Intronic
1096932064 12:55222355-55222377 GAGAGAGTCAGATCAAAATAAGG - Intergenic
1098308449 12:69124499-69124521 GGTTTAATCACACCAAAAAAAGG - Intergenic
1107399147 13:40051817-40051839 AGTATAGTCCCACCACAATAAGG + Intergenic
1108915690 13:55608041-55608063 GGTTTACTCAGCCCAGAATAAGG - Intergenic
1109004881 13:56860242-56860264 GGTATAATAACACCAAAGTAGGG + Intergenic
1109632219 13:65065116-65065138 GATACAGTGAGACCAAAACAAGG + Intergenic
1111119981 13:83834195-83834217 GGTAAACTCAGTTCAAAATATGG - Intergenic
1112072857 13:95874110-95874132 GGAATAAGCAGACAAAAATAAGG - Intronic
1114071891 14:19117325-19117347 GACATTGTCAGAACAAAATAGGG + Intergenic
1114090366 14:19282639-19282661 GACATTGTCAGAACAAAATAGGG - Intergenic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1117169127 14:53072995-53073017 GGGATACTCAGAGCAAAATGAGG + Intronic
1120830421 14:88992956-88992978 GGGATAGTAAGACAGAAATATGG + Intergenic
1121090011 14:91174701-91174723 GGTATAATCAAACCCAAAGAGGG + Intronic
1123421955 15:20142253-20142275 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1123443123 15:20304382-20304404 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1123531183 15:21148793-21148815 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1125550801 15:40543015-40543037 GGTATAGTCACAGCAAACTCAGG + Intronic
1129278565 15:74464812-74464834 GGTATATTAAGACCACAATCTGG + Intergenic
1131198562 15:90376943-90376965 TGGAGAGTCAGACCAAAGTATGG - Intergenic
1131765964 15:95676361-95676383 GGCTAAGTCTGACCAAAATAGGG + Intergenic
1135613275 16:23887386-23887408 GGTATACACAGACACAAATATGG - Intronic
1136718134 16:32301300-32301322 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1136723114 16:32339571-32339593 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1136773843 16:32860846-32860868 GGTAGAGCCAGGCCAAAGTAGGG - Intergenic
1136836509 16:33507570-33507592 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1136862886 16:33713431-33713453 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1136896768 16:34000673-34000695 GGTAGAGCCAGGCCAAAGTAGGG + Intergenic
1138018091 16:53449332-53449354 GGTCCAGTGAGAACAAAATAAGG - Intronic
1141013998 16:80430527-80430549 GGTATTGTCAGACAAAATTCTGG + Intergenic
1203003317 16_KI270728v1_random:178193-178215 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1203008294 16_KI270728v1_random:216465-216487 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1203076263 16_KI270728v1_random:1122957-1122979 GGTAGAGCCAGGCCAAAGTAGGG - Intergenic
1203124359 16_KI270728v1_random:1561572-1561594 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1203134925 16_KI270728v1_random:1714600-1714622 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1156096830 18:33543788-33543810 GGTAGAGTTAGAACAAAAGAGGG + Intergenic
1161612705 19:5251861-5251883 GGTATAGTAAGCACAAACTAGGG + Intronic
1162508837 19:11104917-11104939 GGGATACTCAACCCAAAATAAGG + Intronic
1163874254 19:19853458-19853480 GGTAGAGTCAGACCTAAATAAGG + Intergenic
1163876622 19:19875072-19875094 GATAGAGGCAGACCTAAATAAGG - Intronic
1163882703 19:19940962-19940984 GGTATGGTCAGACCTAAATAAGG + Intergenic
1163912605 19:20210457-20210479 GGCAGGGTCAGACCTAAATAAGG + Intergenic
1163924487 19:20326698-20326720 GGTAGGGCCAGACCAAAATAAGG - Intergenic
1163926374 19:20348328-20348350 GGTAGGGTCAGAACTAAATAAGG + Intergenic
1163932764 19:20413458-20413480 AGTAGGGTCAGACCTAAATAAGG + Intergenic
1163936320 19:20447641-20447663 GGTACAGTCAGACCTAAATAAGG - Intergenic
1163947904 19:20557346-20557368 GATAGGGTCAGACCTAAATAAGG + Intronic
1163956828 19:20650599-20650621 GGTAGGGTCAGACGTAAATAAGG + Intronic
1163969886 19:20781912-20781934 GATTTAGTCAAAACAAAATATGG - Intronic
1163970518 19:20789301-20789323 GGTATAGTCAGACCAAAATAAGG - Intronic
1163975586 19:20848774-20848796 GGTAGGTTCAGACCTAAATAAGG + Intronic
1164198185 19:22991743-22991765 GGTAGAGCCAGACATAAATAAGG + Intronic
1164279553 19:23757718-23757740 GGTAGGGCCAGACCTAAATAAGG + Intronic
1165766825 19:38356754-38356776 GATGTATTCAGACCAAATTATGG - Exonic
1202691695 1_KI270712v1_random:98699-98721 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
928022128 2:27713567-27713589 GGTAAACTGAGTCCAAAATAAGG - Intronic
928529812 2:32179403-32179425 GATATATACATACCAAAATATGG - Intronic
931826960 2:66010616-66010638 GGAATACTCAGACCAAAAATTGG + Intergenic
934274305 2:91565233-91565255 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
934461325 2:94214814-94214836 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
938486139 2:131710786-131710808 GACATTGTCAGAACAAAATAGGG + Intergenic
941078737 2:161035856-161035878 GGTATAGCCAGAAAAATATAAGG - Intergenic
945885304 2:215369726-215369748 TGTATAGTCAGAAAAAAAAATGG + Intronic
1169526793 20:6437201-6437223 GGTATTCTCAGACATAAATACGG + Intergenic
1173145129 20:40518307-40518329 GATGCAGTCAGTCCAAAATATGG + Intergenic
1173409250 20:42794916-42794938 GGTGTGGTCAGACCTATATAAGG - Intronic
1178736458 21:35156943-35156965 AGTAAATTCAGAACAAAATAAGG + Intronic
1179271490 21:39854496-39854518 GGAATATTCAGGCCAAAGTAGGG + Intergenic
1180490333 22:15839680-15839702 GACATTGTCAGAACAAAATAGGG + Intergenic
1180549762 22:16529910-16529932 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
950958254 3:17078178-17078200 GGTATTGTCAGCACAAAATATGG + Intronic
953330344 3:42047603-42047625 GGTAAAGTCAGGACAAAAGAAGG + Intronic
956777102 3:72574355-72574377 GGTAAAGTCTGACCAATACAAGG - Intergenic
959900428 3:111654755-111654777 GGTATAGTCTGACAAAACTCAGG - Intronic
963710007 3:148736810-148736832 GGAATAGTAAGACCAAAAATAGG + Intronic
963777701 3:149456069-149456091 GATAAAGTGAGACAAAAATAAGG - Intergenic
965720051 3:171651546-171651568 GGTAAAGTCAGTGCTAAATAGGG - Intronic
968838847 4:2985606-2985628 GGATTAGTCAGATAAAAATATGG + Intronic
972090888 4:35282030-35282052 GTTATAGCCATAGCAAAATATGG + Intergenic
974095803 4:57362477-57362499 GATATAGTCAAACCATAACAGGG + Intergenic
974448922 4:62025024-62025046 GGTATAGTCCCATCAACATAAGG + Intronic
974878817 4:67729647-67729669 GGTATAGACTGATGAAAATAGGG + Intergenic
976889262 4:90025736-90025758 AATATAATCAGAACAAAATAAGG - Intergenic
986761185 5:10881484-10881506 GTTCTTTTCAGACCAAAATAGGG - Intergenic
987506053 5:18774397-18774419 AATGTAATCAGACCAAAATAGGG - Intergenic
988111256 5:26823707-26823729 TGTATAGGAACACCAAAATAAGG - Intergenic
989283714 5:39674798-39674820 AGTGTAGTCAGGGCAAAATATGG + Intergenic
989466654 5:41764450-41764472 GCTAGAGTCAGATCAAAACAAGG + Intronic
991468266 5:66937888-66937910 GGTATAATCATAAAAAAATATGG - Intronic
993569334 5:89517719-89517741 GGTATTTACAGACCATAATAAGG - Intergenic
995153088 5:108874276-108874298 GGTATAATGAGACCAAAATTAGG + Intronic
996013150 5:118503116-118503138 GCTATAGTCACATCACAATAGGG + Intergenic
997005941 5:129816542-129816564 GCTCTAGTGAGCCCAAAATAGGG - Intergenic
1008261157 6:49367800-49367822 GCTATAGGAAGACTAAAATATGG + Intergenic
1010047812 6:71467752-71467774 ACTATAGAAAGACCAAAATAAGG + Intergenic
1024924249 7:54596420-54596442 GGTACAGTAAGAAGAAAATATGG + Intergenic
1027293590 7:76743018-76743040 GATATAGTCAAACCAGATTATGG + Intergenic
1028090550 7:86695411-86695433 GATATAGTAACACCAATATAGGG + Intronic
1028618302 7:92795449-92795471 AGTATACTCAGACCAAAACTAGG + Intronic
1030834294 7:114264158-114264180 GGTATAATCATACTAGAATAAGG - Intronic
1052532533 9:29706187-29706209 GGTAAAGTCAGATAAAAATAAGG + Intergenic
1053691799 9:40590451-40590473 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1054273004 9:63047040-63047062 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1054303055 9:63391417-63391439 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1054401835 9:64717927-64717949 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1054435440 9:65202242-65202264 GGTAGAGCCAGGCCAAATTAGGG - Intergenic
1054494953 9:65819445-65819467 GGTAGAGCCAGGCCAAATTAGGG + Intergenic
1056617171 9:88178612-88178634 GGTAGAGAAAGCCCAAAATAAGG - Intergenic
1186310397 X:8311371-8311393 GGTACAGTAATACAAAAATATGG + Intergenic
1189963949 X:46352746-46352768 AGTATATTCACAACAAAATAAGG + Intergenic
1190925347 X:54898751-54898773 GGTATATTCAGGGAAAAATAAGG + Intergenic
1197679427 X:129366461-129366483 GGTTTAGTCAGCCCAGAAGAAGG + Intergenic