ID: 1163976351

View in Genome Browser
Species Human (GRCh38)
Location 19:20856729-20856751
Sequence CATTCACAGCTGCTACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 38, 3: 76, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163976351 Original CRISPR CATTCACAGCTGCTACAAAG AGG Intronic
904088206 1:27925908-27925930 CAGTCACTGCTGCTGCAAAGGGG + Intergenic
905008445 1:34730027-34730049 CAGTCACAGGAGCTTCAAAGGGG + Intronic
905489372 1:38331710-38331732 CATTCCCTGCTGCTGCATAGAGG + Intergenic
907196667 1:52692751-52692773 CAGTGATAGCTGCTACAAACTGG - Exonic
907460048 1:54600208-54600230 GCTTCACAGCTCCTACAAAAGGG - Intronic
907706711 1:56838944-56838966 CCTTCACAAGTCCTACAAAGGGG - Intergenic
908050358 1:60222921-60222943 GAATCACATCTGCTACAGAGAGG + Intergenic
908576322 1:65463772-65463794 CATTCACAATTAATACAAAGAGG - Intronic
909206115 1:72759806-72759828 AATTCACAACTGCAACAATGTGG - Intergenic
909606279 1:77511801-77511823 GATTCAAAGTTGCTAGAAAGGGG + Intronic
911367359 1:96954560-96954582 CATTCACAGGTTCTAGAAAGTGG + Intergenic
912841560 1:113043721-113043743 CATTCCCAACTGCAATAAAGTGG - Intergenic
914863287 1:151404556-151404578 CATTCACTTCTGCTAAAAACAGG - Exonic
916237535 1:162605314-162605336 CCTTCACAGCTGTACCAAAGTGG - Intergenic
916962584 1:169904266-169904288 CATTAACAGTTGAAACAAAGTGG + Intergenic
917267569 1:173237649-173237671 CATTCACAATTGCCACAAAAAGG + Intergenic
917275473 1:173326759-173326781 CATTCACAATTGCTTCAAAGAGG + Intergenic
918193251 1:182197026-182197048 CCATCACACCTGCTGCAAAGGGG - Intergenic
918736854 1:188075140-188075162 CATTCACAATAGCTACAAAAAGG - Intergenic
919844462 1:201632626-201632648 CATTCAAACATGCCACAAAGTGG - Intronic
921296439 1:213708288-213708310 CATTCACAATTGCTACAAAGAGG - Intergenic
921799739 1:219388548-219388570 CAGTCACAGCTGATTGAAAGAGG - Intergenic
922565238 1:226597349-226597371 CATGCACAGCTGCTTAAAATGGG - Intronic
924001384 1:239556700-239556722 CATCCACAGCTTCCACACAGAGG + Intronic
924042156 1:239994402-239994424 TATTCACAGCTGCTCCAAATTGG - Intergenic
1064629127 10:17291503-17291525 TATCCAAAGCTGCTAAAAAGAGG - Intergenic
1066344174 10:34566281-34566303 CATTCAAAGCATCTGCAAAGAGG + Intronic
1067235970 10:44449985-44450007 CATTCACAATTGCTACAAAGGGG - Intergenic
1068219596 10:54027182-54027204 CATTCACAATTGCTTCAAAGAGG + Intronic
1068646574 10:59474758-59474780 CATTCACAATTGCTACTAAGAGG + Intergenic
1068848886 10:61713255-61713277 CATTCACAATTGCTACAAAGAGG - Intronic
1069344473 10:67451847-67451869 CATTCAGTGCTGCTACATAAAGG + Intronic
1072823649 10:98583929-98583951 TACTCACAGTTGCTAAAAAGTGG - Intronic
1072870106 10:99109701-99109723 CATTCTCCTCTTCTACAAAGAGG + Intronic
1073587160 10:104721726-104721748 CATTCACAATTGCTTCAAAGAGG - Intronic
1073651652 10:105366860-105366882 AATTCTCAGCTGCTGCAGAGGGG - Intergenic
1073784161 10:106870084-106870106 AATTCACAACTGCCACAAAAAGG + Intronic
1076301089 10:129426878-129426900 CACTCAGAGCAGCTGCAAAGAGG - Intergenic
1077440191 11:2565008-2565030 CATTCACAACAGCCAAAAAGGGG - Intronic
1077697490 11:4407557-4407579 CATTTACAATTGCTACAAAGAGG + Intergenic
1078818241 11:14848731-14848753 CATTCACAATTGCTACAAAGAGG + Intronic
1079813400 11:25024539-25024561 CATTTACAATTGCTTCAAAGAGG + Intronic
1080305447 11:30829962-30829984 CTTTCACAGCTGCTTCAGAATGG - Intergenic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1082112905 11:48296811-48296833 CATTCACAATTGCTTCAAAGAGG + Intergenic
1082164480 11:48929398-48929420 CATTCACAATTGCTTCAAAGAGG + Intergenic
1084402166 11:68950925-68950947 CATCCACCGCTGCTACAATGAGG - Intergenic
1086214675 11:84364259-84364281 CATTCACAATTGCTTCAAAGAGG - Intronic
1086732446 11:90267013-90267035 CATTCACAATTGCTAAAAAGAGG - Intergenic
1086946648 11:92850383-92850405 CATACACAGCTGCCCCAGAGAGG + Intronic
1088696808 11:112373419-112373441 CATTCACAATTGCTTCAAAGAGG - Intergenic
1091546773 12:1506321-1506343 CATTCACAGCAGCCAGAAGGTGG + Intergenic
1091557296 12:1583874-1583896 GATTCACAGCTGCTTCACAATGG + Intronic
1091925548 12:4345000-4345022 CATTCACAATTGCTTCAAAGAGG + Intronic
1092297376 12:7211048-7211070 CATTCACAGGTGCTTCTAAGAGG - Intronic
1092398523 12:8150507-8150529 CATTCACAATTGCTACAAAGAGG - Intronic
1093396701 12:18691957-18691979 CATTCTCAGCTGAGATAAAGTGG + Intronic
1094313085 12:29107483-29107505 CATTCTCAGCTGCTTTCAAGTGG - Intergenic
1095390145 12:41696161-41696183 CATTCACAGTAGCTAAAATGTGG + Intergenic
1096557476 12:52412180-52412202 CATTCACAGCTGTGACCATGTGG + Intergenic
1097452734 12:59755497-59755519 CTTTCACAATTGCTTCAAAGAGG + Intronic
1097661872 12:62438862-62438884 CACTCACAGCTGCTACAATAGGG + Intergenic
1099453139 12:82832015-82832037 CCTTCACAGTTGATAGAAAGTGG + Intronic
1099892616 12:88608486-88608508 CATTCACCATTGCTACAAAAGGG + Intergenic
1099897931 12:88671842-88671864 CATTCACCATTGCTACAAAAGGG + Intergenic
1100768349 12:97894042-97894064 TGTTCACAATTGCTACAAAGAGG - Intergenic
1101725122 12:107382407-107382429 CATTCACAATTGCTACAAAGAGG - Intronic
1102315729 12:111885866-111885888 CATGCACAGTTGCTACCAAAAGG - Intronic
1102592573 12:113968002-113968024 TATTCACAGTAGCCACAAAGCGG - Intergenic
1102963614 12:117110108-117110130 CATTGACAGGTGCTACAACGTGG - Intergenic
1103257230 12:119552295-119552317 CTTTCACACCTGCTGCAAAACGG - Intergenic
1105037550 12:132937768-132937790 TATTCAAAACTGCTAAAAAGTGG + Intronic
1105379971 13:19877815-19877837 CATTCACAGTAGCTAAAATGTGG - Intergenic
1105972448 13:25442165-25442187 TATTCACAGCAGCTACAACGTGG - Intronic
1108194407 13:47977907-47977929 CATTCACAATTGCTACAAAGAGG + Intronic
1110699514 13:78530431-78530453 CATTCACAATTGCTTCAAAGAGG + Intergenic
1112860639 13:103826012-103826034 TATTCACAATTGCTACAAAGAGG - Intergenic
1112886895 13:104184795-104184817 CATTCACAATGACTACAAAGAGG - Intergenic
1113673508 13:112192191-112192213 CACTCACAGCTTATACAAAACGG - Intergenic
1114748037 14:25171445-25171467 CATTCACAATCGCTACAAAGAGG + Intergenic
1114749551 14:25187795-25187817 CATTCACAATTGCTACAAAGAGG + Intergenic
1114765530 14:25366512-25366534 CATTCATAATTGCTTCAAAGAGG - Intergenic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115894978 14:38076154-38076176 CATTCACAATTGCTTCAAAGAGG - Intergenic
1116527896 14:45929645-45929667 CATGCACAGCTGTATCAAAGAGG - Intergenic
1118078167 14:62325878-62325900 CATTCACAATTGCTTCAAAGAGG - Intergenic
1120239997 14:81938948-81938970 AATTCCCAGATGCTTCAAAGGGG - Intergenic
1120638259 14:86978334-86978356 CATTCACAACTGCCACAAAGAGG + Intergenic
1120842748 14:89100527-89100549 CATTCACAATTGCTATGAAGAGG - Intergenic
1122000691 14:98649484-98649506 CAATCACAGCGGTTTCAAAGAGG - Intergenic
1122726241 14:103755235-103755257 CATTTCCTGCTGCTACAAAGTGG + Intronic
1123157673 14:106244655-106244677 CATTCACAATTGCTTCAAAGGGG - Intergenic
1124233661 15:27968290-27968312 GAATCACAGGTGCCACAAAGGGG + Intronic
1125216262 15:37278955-37278977 CATTCACAATTGCTGCAAAAGGG - Intergenic
1125388538 15:39165988-39166010 CATTCAGAGCTGATAGGAAGAGG + Intergenic
1125400166 15:39293791-39293813 CATTCACAATTGCTTCAAAAAGG - Intergenic
1125728760 15:41881460-41881482 CATACACAGCTTCTTGAAAGAGG + Intronic
1125795509 15:42401594-42401616 CATTCACAGCTGCCTCTCAGAGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126751369 15:51880749-51880771 TATTCACAACAGCTAAAAAGTGG - Intronic
1126908827 15:53397596-53397618 CATTCACAGCTCCTACATGAAGG + Intergenic
1127628459 15:60803274-60803296 CATTCCCAGCTGGTCCGAAGGGG - Intronic
1127645317 15:60952683-60952705 CATTCATAATTGCTACAAAGAGG + Intronic
1129001699 15:72340866-72340888 CACACACACCTGCTTCAAAGAGG + Intronic
1129587317 15:76881445-76881467 CATTCACAATAGCTAAAAAGGGG + Intronic
1129790082 15:78335299-78335321 CAGTAACAACTGCTCCAAAGAGG - Intergenic
1130779534 15:87020740-87020762 CATTCACAATTGCTACAAAAAGG + Intronic
1131243818 15:90772730-90772752 CAGTAACAGCTGTTACAAGGAGG + Intronic
1131277765 15:90996156-90996178 CATTCACAGCACCAACACAGTGG + Intergenic
1133547484 16:6821794-6821816 CATTCACAACAGCTAGAAAATGG - Intronic
1136361837 16:29785626-29785648 CATGCACAGCCGCTACAAACGGG + Intergenic
1136743155 16:32557996-32558018 CCTTCACAGATTCTACAAAAAGG - Intergenic
1137958873 16:52861681-52861703 CGTTCACAGCGGCTACAAAAAGG + Intergenic
1139800251 16:69516687-69516709 CATTCACAATTGCTTCAAAGAGG + Intergenic
1140544610 16:75794838-75794860 CATTCACAGTAGCCAAAAAGTGG - Intergenic
1141875991 16:86824914-86824936 CATTCCCAGCTGATGCCAAGCGG + Intergenic
1142042820 16:87906068-87906090 CATCAGCAGCTGCTACAAATGGG + Intronic
1142101431 16:88273715-88273737 TATTCACAACTGCTAAAAGGTGG + Intergenic
1203026444 16_KI270728v1_random:517233-517255 CCTTCACAGATTCTACAAAAAGG + Intergenic
1203045277 16_KI270728v1_random:817198-817220 CCTTCACAGATTCTACAAAAAGG - Intergenic
1142807796 17:2380573-2380595 CATACACAGCTCCTCCAAGGGGG - Exonic
1142936613 17:3339016-3339038 AAATCACAACTGCTACAAAGAGG - Intergenic
1143363839 17:6392651-6392673 TATTCTCAGCTGTTACAAGGGGG + Intergenic
1144949935 17:18988680-18988702 CATTCCCAGGTGTTACAAGGAGG - Intronic
1147162537 17:38576530-38576552 CGGTCACAGCAGATACAAAGTGG - Intronic
1148391136 17:47274001-47274023 TATTCACAGCCACTACACAGGGG - Intronic
1151685980 17:75646884-75646906 TATTCTCAGCTGCTCCAAGGAGG + Intronic
1154040530 18:10850450-10850472 CTTTCACAGCTGCGAGAATGTGG + Intronic
1154521064 18:15230852-15230874 CATTCACAATTGCTTCAAAGAGG - Intergenic
1155869617 18:31009597-31009619 CATTCACAGTGGATACACAGAGG + Intronic
1156981198 18:43290308-43290330 CATTCACAATTGCTTCAAAGAGG + Intergenic
1157497003 18:48163228-48163250 CATTCACAGTTATTATAAAGGGG - Intronic
1157854702 18:51094565-51094587 CATTCACAATTGCTACCAAGAGG - Intergenic
1159143852 18:64428641-64428663 CATTCACAATTGCTTCAAAGAGG + Intergenic
1159925083 18:74262103-74262125 CATTTACAACTGCCACAGAGGGG + Intronic
1160730017 19:637482-637504 CAACCACAGAGGCTACAAAGAGG + Intergenic
1160886497 19:1351834-1351856 GATTCACAGTTGCAATAAAGCGG - Intergenic
1163025367 19:14507972-14507994 AACTCACAGTTGCCACAAAGCGG + Intergenic
1163040040 19:14595260-14595282 GATTCACAGCTGGGAGAAAGGGG - Exonic
1163132957 19:15287753-15287775 AATTCAGAGGTGCTACAATGTGG - Intronic
1163976351 19:20856729-20856751 CATTCACAGCTGCTACAAAGAGG + Intronic
1164332060 19:24268675-24268697 CCTTCACAGATTCTACAAAAAGG + Intergenic
1164363539 19:27546543-27546565 CCTTCACAGATTCTACAAAAAGG - Intergenic
1166241178 19:41495254-41495276 CCATCACAGCTGCTACAGTGGGG + Intergenic
1166771201 19:45283697-45283719 CATTCACAACAGCCAAAAAGTGG - Intronic
926179427 2:10628003-10628025 CTTTCACAGCTTCTAAAAGGAGG - Intronic
927607631 2:24501981-24502003 CAATCACATCTGTTGCAAAGTGG - Intronic
927912816 2:26913535-26913557 CATTCACAGCAGCTAAAAGGTGG - Intronic
929045094 2:37781324-37781346 TCTTCACAGCTTCTAAAAAGGGG - Intergenic
929063794 2:37951224-37951246 CACTCTTAGCTGCTGCAAAGAGG + Exonic
929965452 2:46531337-46531359 TACTGACAGCTGCTACAATGTGG - Intronic
931255141 2:60565003-60565025 CATGGACAGCTTCCACAAAGAGG + Intergenic
931358176 2:61555168-61555190 CATTCAGAGATGCGACAAAAAGG + Intergenic
931935440 2:67191559-67191581 CATTCACAATTGCTTCAAAGAGG - Intergenic
934015369 2:87874956-87874978 CATTCACAATTGCTATGAAGAGG - Intergenic
934637081 2:95999770-95999792 CATTCACAATTGCTTCAAAGAGG - Intergenic
935836065 2:107055254-107055276 TATTTACAGCTTTTACAAAGTGG - Intergenic
936879672 2:117234359-117234381 CATTCACAATTGCTACAAAGAGG + Intergenic
938131985 2:128724580-128724602 CAGACACAGGTGCTATAAAGGGG + Intergenic
938752336 2:134344641-134344663 GTCTCACAGCTGCTACATAGTGG + Intronic
940445308 2:153770660-153770682 CAGTCACAGCTGATACACATAGG + Intergenic
941518321 2:166507352-166507374 CATTCACAATCGCTACAAAGAGG - Intergenic
942487922 2:176458773-176458795 TATTCATAATTGCTACAAAGTGG - Intergenic
944126745 2:196302667-196302689 CATTCACAATTGCTACAAAAAGG - Intronic
944170250 2:196767962-196767984 AATTCACAGTACCTACAAAGTGG - Intronic
945214391 2:207417847-207417869 CATTCCCAGCAGCTCCAAATTGG + Intergenic
1170496982 20:16935016-16935038 CATTCACAATTGCTACAAAGAGG + Intergenic
1170798167 20:19568331-19568353 CATTCACAACAGCTAAAAGGTGG + Intronic
1171814443 20:29772093-29772115 CATTCACAATTGCTTCAAAGAGG + Intergenic
1172006723 20:31823133-31823155 CAAACACAGCAGCTATAAAGCGG - Intronic
1172052655 20:32130705-32130727 CATTCTATGCTGGTACAAAGGGG - Intronic
1172945390 20:38683672-38683694 CCTTCCCAGCTGCTACAACCTGG - Intergenic
1172961274 20:38801841-38801863 TATTCACAACAGCTAAAAAGTGG - Intergenic
1175591612 20:60197163-60197185 CATTCACAATTGCTACAAAAAGG - Intergenic
1177202402 21:17972534-17972556 CATTCACAATTGCTACAAAGAGG + Intronic
1179076395 21:38126355-38126377 TACTCACAGGTCCTACAAAGAGG + Intronic
1179183948 21:39069130-39069152 CATTCATAATTGCTACAAAAAGG + Intergenic
1180317896 22:11292647-11292669 CATTCACAATTGCTTCAAAGAGG + Intergenic
1182290378 22:29273476-29273498 CATTCACAGCTTCTCAAAAGGGG - Intronic
950292497 3:11796902-11796924 CATTCACAACTGCCATAAAAAGG + Intronic
950582942 3:13874511-13874533 CATTCACTGCTGCAACTAAAGGG + Intronic
952505441 3:34003148-34003170 CATTTACAGATGCTGAAAAGAGG - Intergenic
952741154 3:36736331-36736353 CACTCACAGCAGCCACAAAGGGG + Intronic
953271000 3:41445115-41445137 CATTCACAATTGCTTCAAAAAGG + Intronic
953938611 3:47069694-47069716 CATTCCCATCTGCTACTATGAGG + Intronic
953938655 3:47070147-47070169 CATTAACTGCCGCTACAGAGTGG - Intronic
955890432 3:63644669-63644691 CAATCACAGCTGCTGTGAAGCGG + Intergenic
956437613 3:69248792-69248814 CTTTCACAGCTGCCCCGAAGGGG - Intronic
957493081 3:80954791-80954813 CCTTCACAGATTCTACAAAAAGG + Intergenic
957670629 3:83296781-83296803 CACTCACTGTTGCTATAAAGTGG + Intergenic
957840749 3:85666133-85666155 CATTCACAATTTCTACAAACAGG + Intronic
958013545 3:87912312-87912334 CATTCACAATTGCTAAAAAAAGG + Intergenic
958218072 3:90618786-90618808 CACTCACAGATACTACAAAAAGG + Intergenic
958442325 3:94170996-94171018 CATTGGCTGCTACTACAAAGAGG + Intergenic
961203774 3:125064798-125064820 CATTTGCAGCTGTTACAAATAGG + Intergenic
961232396 3:125328188-125328210 CATTCAGAGATGCTACAACCTGG + Intronic
962139788 3:132777155-132777177 TATTCACAGCAGCTAAAACGTGG - Intergenic
963022007 3:140881198-140881220 CATTCACAATTGCTACAAAGAGG + Intergenic
967799560 3:193641160-193641182 CATCCACAGCTTCTACAATTAGG - Intronic
967881945 3:194307740-194307762 CATCAAGAGGTGCTACAAAGAGG - Intergenic
967944932 3:194797076-194797098 CATGCACAGCTGCTACCCAGGGG - Intergenic
967950478 3:194836570-194836592 CATTTGCAGCTGGTACAGAGAGG + Intergenic
971377523 4:26067142-26067164 CTATCACAGCTGCTTCATAGAGG - Intergenic
973599387 4:52526580-52526602 CATTCACAAATGCTACAAAGAGG + Intergenic
974793947 4:66724615-66724637 TATCCACGGCTGCTAAAAAGTGG + Intergenic
975062043 4:70015396-70015418 CATTCACAATTGCTTCAAAGAGG - Intergenic
975384411 4:73738941-73738963 CATTCACATCTCCTACAATAAGG + Intergenic
975639524 4:76485496-76485518 CGATCAAAGCTTCTACAAAGAGG - Intronic
977648437 4:99440993-99441015 CATTCACAATTGCCACAAAAAGG + Intergenic
978467661 4:109026642-109026664 CATGCACAGTTACTAAAAAGAGG - Intronic
978565876 4:110080984-110081006 CATTCACAATTGCTTCAAAGAGG + Intronic
979026740 4:115587116-115587138 CATTCGCAATTGCTACAAGGAGG - Intergenic
981400715 4:144310761-144310783 CATTCAAGGCTACTACTAAGGGG - Intergenic
981434455 4:144703649-144703671 CAGTCAGAGCTGGGACAAAGGGG + Intronic
981681535 4:147405051-147405073 CATTCACAATTGCTCCAAAAAGG - Intergenic
981859439 4:149337321-149337343 CATTCACAATTGCTACAAAGAGG - Intergenic
982305564 4:153927081-153927103 GATACACAGCTGGTACATAGTGG - Intergenic
982669942 4:158308268-158308290 CATTCACAATTGCTACAAAGAGG + Intergenic
983958126 4:173720869-173720891 CATTCACAATTGCTACAAAGAGG + Intergenic
984255308 4:177383217-177383239 CATTTGCAGCTGCTAGAAAAAGG - Intergenic
984387739 4:179084956-179084978 CATTCACAGTTACTAAAATGTGG - Intergenic
984947188 4:184978972-184978994 CATTCACAGCTGTCCCAAGGGGG + Intergenic
986549072 5:8932772-8932794 CATTCACAATTGCTACAAAGAGG - Intergenic
986665134 5:10095699-10095721 CATTCATAATTGTTACAAAGAGG + Intergenic
987418841 5:17694056-17694078 CATTCACAGCGACCACAGAGGGG + Intergenic
987725761 5:21697058-21697080 CATTCAGAATTGCTACAAAGAGG - Intergenic
987932092 5:24414851-24414873 CACTCCCAGCTGCTACCATGGGG - Intergenic
989300306 5:39883868-39883890 GTATCACTGCTGCTACAAAGTGG - Intergenic
989835589 5:45985380-45985402 CCTTCACAGATTCTACAAAAAGG - Intergenic
990037262 5:51336684-51336706 CTTTTACAGATGTTACAAAGAGG - Intergenic
990801573 5:59610064-59610086 CATTCATAGCTGGAACAAACTGG + Intronic
991225502 5:64265969-64265991 TATTCACAATTGCTACTAAGAGG - Intronic
991657154 5:68915543-68915565 CATTCATAACTGCTACAATTAGG + Intergenic
992650639 5:78855829-78855851 CATTCCCAGCTGCTTCCAATTGG + Intronic
992756863 5:79915342-79915364 CATTCACAGTTGCTACTAAGAGG + Intergenic
994114780 5:96050033-96050055 TATTGTCAGCTGCCACAAAGAGG + Intergenic
994624667 5:102203652-102203674 CATTCACAATTGCTACAAAGAGG + Intergenic
995810726 5:116104396-116104418 CATTCACAATTGCTACAAAAAGG - Intronic
998062166 5:139127308-139127330 CATTCACAGCTCTCACAAACTGG + Intronic
1000384547 5:160662036-160662058 CATTCACAATTGCTTCAAAAAGG + Intronic
1001009794 5:168087077-168087099 CATTCACTGCTGCTATAACTTGG - Intronic
1001114403 5:168927086-168927108 TATTCACAACAGCTAAAAAGTGG + Intronic
1002418225 5:179131990-179132012 CTTTCATAGCTGCTGCCAAGCGG + Intronic
1002834051 6:850648-850670 CATTCACAATTGCTACAAAGAGG + Intergenic
1005827973 6:29646977-29646999 CCTTCATAGCTCCTACAATGTGG + Intergenic
1006802632 6:36768943-36768965 CTTGCACAGCAGCTCCAAAGTGG - Intronic
1006880134 6:37332035-37332057 AAATCATATCTGCTACAAAGAGG - Exonic
1008463152 6:51799501-51799523 TATTCCCAGCTGCTTCAAACTGG + Intronic
1009720991 6:67469313-67469335 CATTCACAATAGCTTCAAAGAGG + Intergenic
1009983637 6:70756760-70756782 CATTCACAGTTGCTTCAAAGAGG + Intronic
1010576567 6:77539228-77539250 CATTCACAATTGCTACAAAGAGG + Intergenic
1012590448 6:100973788-100973810 CATTCACAATTGCTACAAAGAGG + Intergenic
1012851525 6:104452179-104452201 CATTGCCAGCTGCTAGAAAATGG + Intergenic
1014784748 6:125606165-125606187 CATTCACAATTGCTTCAAATTGG - Intergenic
1015202101 6:130594296-130594318 CATCCACATCTGCTACTAAGAGG + Intergenic
1015455889 6:133425668-133425690 CAGTCATAGCGGCAACAAAGTGG - Intronic
1015993924 6:138978679-138978701 CATTCACATTAGCTTCAAAGAGG - Intronic
1016111868 6:140234483-140234505 CATTCACAATTGCAACAAAGAGG + Intergenic
1016452065 6:144193646-144193668 TATTCACAGCAGCCAAAAAGTGG - Intergenic
1018681206 6:166267192-166267214 CACACACAGCTCCTAAAAAGAGG + Intergenic
1018806242 6:167262996-167263018 CATTCACAATTGCTACAAAGAGG + Intergenic
1019303301 7:320321-320343 CACTCACAACAGCCACAAAGTGG + Intergenic
1019655141 7:2189359-2189381 TATTCACAGTAGCTACAATGTGG + Intronic
1019725893 7:2602536-2602558 CACCCACAGCTGCTTCTAAGTGG + Intronic
1020519188 7:9165124-9165146 CATTCACAATAGCCACAAAGAGG - Intergenic
1021379516 7:19950469-19950491 CATTCACAATTGCTACAAAGAGG - Intergenic
1021816280 7:24450382-24450404 CATTCAGAGCCGCTCCAAATGGG - Intergenic
1023109758 7:36797361-36797383 CATTCCCAGCTGCTACCAAGTGG + Intergenic
1023666918 7:42532859-42532881 CATTCACAATTGCTACAGAAAGG + Intergenic
1025309484 7:57912630-57912652 CACTCACAGATTCTACAAAAAGG + Intergenic
1025314029 7:57994531-57994553 CACTCACAGATTCTACAAAAAGG - Intergenic
1028612765 7:92730805-92730827 TATTCACAGCAGCCAAAAAGTGG - Intronic
1028626713 7:92886061-92886083 CAATCACAATTGCTACAAAAAGG - Intergenic
1030611436 7:111693823-111693845 CATTCACATCAGCTACCAACTGG + Intergenic
1030801748 7:113860678-113860700 CATTCACAATTGCTACAAAGAGG + Intergenic
1031067497 7:117121144-117121166 TATTCACAGCACCTGCAAAGTGG + Intronic
1033484140 7:141771693-141771715 CATTCACAATTGCTTCAAAGAGG - Intronic
1034821231 7:154218104-154218126 CATGCACAGCTGATAAAATGGGG - Intronic
1035670487 8:1413188-1413210 CATACAAAGGTGCTACAGAGAGG - Intergenic
1035688374 8:1542663-1542685 CATTCATAGTTGCCAAAAAGTGG - Intronic
1035992525 8:4508701-4508723 CATTTTTAGCTGCTTCAAAGGGG + Intronic
1035992585 8:4509379-4509401 CATTTTTAGCTGCTTCAAAGGGG + Intronic
1036748848 8:11430348-11430370 CAAGCACAGCTGTTTCAAAGGGG - Intronic
1037489601 8:19385678-19385700 CATACACAGCTCCTTCAAAACGG + Intronic
1038828807 8:31034131-31034153 CTTTCCCAGCTGCTCCAGAGGGG - Intronic
1040112731 8:43577093-43577115 CTTTCACAGATTCTACAAAGAGG - Intergenic
1040117724 8:43643430-43643452 CCTTCACAGATTCTCCAAAGAGG - Intergenic
1040118652 8:43655273-43655295 ACTTCACAGATTCTACAAAGAGG - Intergenic
1040282871 8:46075261-46075283 CCTTCACAGATTCTACAAAAAGG - Intergenic
1041404807 8:57486354-57486376 CATTTACAATTGCTACTAAGAGG + Intergenic
1041580906 8:59458576-59458598 CATTCACAATTGCTTCAAAGAGG - Intergenic
1041889075 8:62848418-62848440 CATTCACAATTGCCACAAAAAGG - Intronic
1042070412 8:64927206-64927228 CATTCACAATTGCTACAAAGAGG - Intergenic
1043212826 8:77546710-77546732 CATTTACAACAGCTACAAAAAGG - Intergenic
1043304604 8:78778992-78779014 CATTTACAATTGCTAAAAAGAGG - Intronic
1043312089 8:78873318-78873340 CATTCATATTTGCTAAAAAGAGG - Intergenic
1043725513 8:83605812-83605834 CATTCACAATTGCTACAAAGAGG + Intergenic
1043726576 8:83619045-83619067 CATTCACAATTGCTACAAAGAGG - Intergenic
1044131897 8:88533814-88533836 CATTCACAATTGCTTCAAAGAGG - Intergenic
1044175825 8:89120966-89120988 CATTTTCAACTGCTACAAAAGGG - Intergenic
1045997125 8:108376096-108376118 CATTCACAATTGCTACAAAGAGG - Intronic
1046285330 8:112086207-112086229 CATTCACAATTGTTACAAAGAGG + Intergenic
1047054527 8:121149401-121149423 CATTCACAATTGCTGCAAAGAGG - Intergenic
1047162227 8:122393181-122393203 CTTTCAAAACTGCTGCAAAGTGG - Intergenic
1049293042 8:141814019-141814041 CCTCCACAGCTGCTTTAAAGGGG + Intergenic
1050300082 9:4249371-4249393 CATTCACAATTGCTACAAAGAGG - Intronic
1050321044 9:4452561-4452583 CATTCACAATTGCTACAAAGAGG + Intergenic
1050864133 9:10476376-10476398 CATTCACAATTGCTACAAAGAGG + Intronic
1051223211 9:14872417-14872439 CATTCACAGTTGCTTCAAAGAGG - Intronic
1051547176 9:18290004-18290026 CCTTCACAGCAGGTTCAAAGAGG + Intergenic
1051584786 9:18715478-18715500 CATTCACAATTGCTTCAAAGAGG + Intronic
1052408335 9:28090956-28090978 CATTCACAATTGTTTCAAAGAGG + Intronic
1053568428 9:39278191-39278213 CATTCACAATTGCTTCAAAGAGG + Intronic
1053834397 9:42119221-42119243 CATTCACAATTGCTTCAAAGAGG + Intronic
1054128717 9:61340819-61340841 CATTCACAATTGCTTCAAAGAGG - Intergenic
1054596143 9:67068311-67068333 CATTCACAATTGCTTCAAAGAGG - Intergenic
1054603093 9:67146962-67146984 CATTCACAATTGCTTCAAAGAGG - Intergenic
1055603521 9:77944764-77944786 GAATCACAGCTGCTTTAAAGAGG - Intronic
1056085116 9:83140436-83140458 CATTCAATGCTACTCCAAAGAGG - Intergenic
1058203159 9:102068522-102068544 CAGTCACACCTGGAACAAAGAGG - Intergenic
1059613094 9:115920196-115920218 CATTCACAATTGCTTCAAAGGGG + Intergenic
1060240799 9:121901086-121901108 CATTTACAGTAGCCACAAAGAGG - Intronic
1060713463 9:125894875-125894897 TTTTCACAACTGCTATAAAGCGG - Intronic
1061107290 9:128541188-128541210 CCATCACCGCTGCTGCAAAGAGG + Exonic
1185768997 X:2750523-2750545 CCGTGACATCTGCTACAAAGTGG - Intergenic
1185979552 X:4761638-4761660 CCTTCACAGCTTCTAAAAACAGG - Intergenic
1186249833 X:7653730-7653752 CATTCAGTGCTGCTGCAATGTGG + Intergenic
1187890114 X:23926408-23926430 CATTCTCAGCAGCTAAAAAGTGG - Intronic
1189994795 X:46628141-46628163 CACTCTTAGCTGCTCCAAAGTGG + Intronic
1191004039 X:55691274-55691296 TATTCACAATTGCTACCAAGAGG + Intergenic
1191092701 X:56640394-56640416 CATTCACAATTGCTTCAATGAGG + Intergenic
1191134357 X:57047827-57047849 CATTCAGAATTGCTACTAAGAGG + Intergenic
1192982479 X:76360796-76360818 CATTCTCAATTGCTACTAAGAGG - Intergenic
1193001928 X:76572417-76572439 CATTCACAATTACCACAAAGAGG + Intergenic
1193069286 X:77290790-77290812 CATTTACAATTGCTTCAAAGAGG - Intergenic
1193072722 X:77323259-77323281 CATTCGCAATTGCTTCAAAGAGG + Intergenic
1194016603 X:88629055-88629077 CATTCACAACTGCTACAAAAAGG + Intergenic
1194679875 X:96839675-96839697 CATTCACATCTGACAGAAAGGGG - Intronic
1194949804 X:100111453-100111475 CATTCGCAATTACTACAAAGAGG - Intergenic
1195098411 X:101528725-101528747 CATTCACAATTGCTTCAAAGAGG + Intronic
1195784888 X:108508279-108508301 CATTCACAATTGCCACAAAAAGG + Intronic
1196945476 X:120820725-120820747 CATTCACAATTGCTACAAACAGG - Intergenic
1197157651 X:123287657-123287679 CATTCACAATTGCTACAAACAGG + Intronic
1198396255 X:136221919-136221941 CAATTACTGCTACTACAAAGTGG + Intronic
1199129113 X:144163553-144163575 CATTCACAATTGCTATGAAGAGG + Intergenic
1199359408 X:146901051-146901073 CATCAACAGCTGCTACTAAATGG - Intergenic
1200335072 X:155341851-155341873 CATTCACATTTGCTTCAAAGAGG - Intergenic
1200351395 X:155499370-155499392 CATTCACATTTGCTTCAAAGAGG + Intronic
1201013603 Y:9575007-9575029 CATTCACAATTGCTTCAAAGAGG + Intergenic
1201072559 Y:10161821-10161843 CATTCACAATTGCTTCAAAGAGG - Intergenic
1201596457 Y:15675472-15675494 CATTCACAATTGCTACAATGAGG + Intergenic
1201775805 Y:17664439-17664461 CATTCACAATTGCTTCAAGGAGG - Intergenic
1201825751 Y:18241553-18241575 CATTCACAATTGCTTCAAGGAGG + Intergenic
1202041667 Y:20691756-20691778 CATTCACAATTGCTACAAAGAGG - Intergenic