ID: 1163977312

View in Genome Browser
Species Human (GRCh38)
Location 19:20864485-20864507
Sequence GGTCTCCTGAAGCTTCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163977312_1163977318 23 Left 1163977312 19:20864485-20864507 CCACACCGAAGCTTCAGGAGACC No data
Right 1163977318 19:20864531-20864553 ATGACCAACTCTTGAGCCCAAGG No data
1163977312_1163977316 0 Left 1163977312 19:20864485-20864507 CCACACCGAAGCTTCAGGAGACC No data
Right 1163977316 19:20864508-20864530 TCTCCTTATCTGTGCAAGGATGG No data
1163977312_1163977314 -4 Left 1163977312 19:20864485-20864507 CCACACCGAAGCTTCAGGAGACC No data
Right 1163977314 19:20864504-20864526 GACCTCTCCTTATCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163977312 Original CRISPR GGTCTCCTGAAGCTTCGGTG TGG (reversed) Intergenic
No off target data available for this crispr