ID: 1163979384

View in Genome Browser
Species Human (GRCh38)
Location 19:20884546-20884568
Sequence CACCCACAAGGTCATTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163979381_1163979384 12 Left 1163979381 19:20884511-20884533 CCAATCATTCATTGTGGGAAGAA No data
Right 1163979384 19:20884546-20884568 CACCCACAAGGTCATTAGAGTGG No data
1163979377_1163979384 27 Left 1163979377 19:20884496-20884518 CCTGTTCGTTGTCACCCAATCAT No data
Right 1163979384 19:20884546-20884568 CACCCACAAGGTCATTAGAGTGG No data
1163979380_1163979384 13 Left 1163979380 19:20884510-20884532 CCCAATCATTCATTGTGGGAAGA No data
Right 1163979384 19:20884546-20884568 CACCCACAAGGTCATTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163979384 Original CRISPR CACCCACAAGGTCATTAGAG TGG Intergenic
No off target data available for this crispr