ID: 1163988005

View in Genome Browser
Species Human (GRCh38)
Location 19:20970978-20971000
Sequence GAGCCACATAACCTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163988005_1163988014 24 Left 1163988005 19:20970978-20971000 CCAGCATCCAGGTTATGTGGCTC No data
Right 1163988014 19:20971025-20971047 TGGGATTGTGACATATCAGTGGG No data
1163988005_1163988009 5 Left 1163988005 19:20970978-20971000 CCAGCATCCAGGTTATGTGGCTC No data
Right 1163988009 19:20971006-20971028 CCCTGTCTCTGCCCACATGTGGG No data
1163988005_1163988013 23 Left 1163988005 19:20970978-20971000 CCAGCATCCAGGTTATGTGGCTC No data
Right 1163988013 19:20971024-20971046 GTGGGATTGTGACATATCAGTGG No data
1163988005_1163988007 4 Left 1163988005 19:20970978-20971000 CCAGCATCCAGGTTATGTGGCTC No data
Right 1163988007 19:20971005-20971027 GCCCTGTCTCTGCCCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163988005 Original CRISPR GAGCCACATAACCTGGATGC TGG (reversed) Intergenic
No off target data available for this crispr