ID: 1163992205

View in Genome Browser
Species Human (GRCh38)
Location 19:21008991-21009013
Sequence GACTGTGAGCTATACTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163992203_1163992205 -5 Left 1163992203 19:21008973-21008995 CCATCTTGAGTATCAGGAGACTG No data
Right 1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG No data
1163992198_1163992205 9 Left 1163992198 19:21008959-21008981 CCCAACCTCCGAGACCATCTTGA No data
Right 1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG No data
1163992199_1163992205 8 Left 1163992199 19:21008960-21008982 CCAACCTCCGAGACCATCTTGAG No data
Right 1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG No data
1163992201_1163992205 1 Left 1163992201 19:21008967-21008989 CCGAGACCATCTTGAGTATCAGG No data
Right 1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG No data
1163992200_1163992205 4 Left 1163992200 19:21008964-21008986 CCTCCGAGACCATCTTGAGTATC No data
Right 1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163992205 Original CRISPR GACTGTGAGCTATACTTGGA TGG Intergenic
No off target data available for this crispr