ID: 1163995310

View in Genome Browser
Species Human (GRCh38)
Location 19:21040079-21040101
Sequence ATTTGGAAGATGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6372
Summary {0: 2, 1: 1, 2: 30, 3: 508, 4: 5831}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163995310_1163995317 12 Left 1163995310 19:21040079-21040101 CCTCCCACCTTCATCTTCCAAAT 0: 2
1: 1
2: 30
3: 508
4: 5831
Right 1163995317 19:21040114-21040136 ATGTATCAGCCACTACTCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 248
1163995310_1163995318 15 Left 1163995310 19:21040079-21040101 CCTCCCACCTTCATCTTCCAAAT 0: 2
1: 1
2: 30
3: 508
4: 5831
Right 1163995318 19:21040117-21040139 TATCAGCCACTACTCCCAGGTGG 0: 1
1: 0
2: 2
3: 12
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163995310 Original CRISPR ATTTGGAAGATGAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr