ID: 1163995310 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:21040079-21040101 |
| Sequence | ATTTGGAAGATGAAGGTGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6372 | |||
| Summary | {0: 2, 1: 1, 2: 30, 3: 508, 4: 5831} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163995310_1163995317 | 12 | Left | 1163995310 | 19:21040079-21040101 | CCTCCCACCTTCATCTTCCAAAT | 0: 2 1: 1 2: 30 3: 508 4: 5831 |
||
| Right | 1163995317 | 19:21040114-21040136 | ATGTATCAGCCACTACTCCCAGG | 0: 1 1: 0 2: 1 3: 13 4: 248 |
||||
| 1163995310_1163995318 | 15 | Left | 1163995310 | 19:21040079-21040101 | CCTCCCACCTTCATCTTCCAAAT | 0: 2 1: 1 2: 30 3: 508 4: 5831 |
||
| Right | 1163995318 | 19:21040117-21040139 | TATCAGCCACTACTCCCAGGTGG | 0: 1 1: 0 2: 2 3: 12 4: 235 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163995310 | Original CRISPR | ATTTGGAAGATGAAGGTGGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||