ID: 1163997929

View in Genome Browser
Species Human (GRCh38)
Location 19:21069534-21069556
Sequence AGTAATATGCAGAAGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163997926_1163997929 10 Left 1163997926 19:21069501-21069523 CCTGTTTAATTAATTGTACTGGG No data
Right 1163997929 19:21069534-21069556 AGTAATATGCAGAAGAAAACTGG No data
1163997924_1163997929 11 Left 1163997924 19:21069500-21069522 CCCTGTTTAATTAATTGTACTGG No data
Right 1163997929 19:21069534-21069556 AGTAATATGCAGAAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163997929 Original CRISPR AGTAATATGCAGAAGAAAAC TGG Intergenic
No off target data available for this crispr