ID: 1163999952

View in Genome Browser
Species Human (GRCh38)
Location 19:21089354-21089376
Sequence CTTATTACCAGACTTTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 3, 2: 28, 3: 60, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163999950_1163999952 11 Left 1163999950 19:21089320-21089342 CCATAGTGCTCTTTTAAAAAGTC 0: 1
1: 4
2: 3
3: 54
4: 384
Right 1163999952 19:21089354-21089376 CTTATTACCAGACTTTAGTCAGG 0: 1
1: 3
2: 28
3: 60
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163999952 Original CRISPR CTTATTACCAGACTTTAGTC AGG Intronic
900816055 1:4846853-4846875 CTTATTATTAGATTTTAGCCAGG + Intergenic
903149218 1:21393635-21393657 CTTATTACCCGACTGTAGCCTGG - Intergenic
903495186 1:23761469-23761491 CTTATTAGGAGTCTTTAGGCAGG + Exonic
906852946 1:49271428-49271450 CTTATTATCAGATTTTAGCCAGG - Intronic
906859428 1:49342968-49342990 CTTATTACCAGACTCCAGTCAGG - Intronic
906967495 1:50472763-50472785 CTTTTTAACAGTCTTTAGTTTGG + Intronic
907212109 1:52832806-52832828 CTTATTACCCAATTTTAGCCAGG + Intergenic
908577119 1:65471896-65471918 CTCATTACTTTACTTTAGTCTGG + Intronic
909575759 1:77174227-77174249 CTTACTACCCCACTTTAGCCAGG - Intronic
910809908 1:91225527-91225549 CTTATTATCAGATTTTAGCCAGG - Intergenic
912043774 1:105426875-105426897 CTTATTGCCTCACTTTATTCAGG + Intergenic
916272880 1:162962895-162962917 ATGACTACCAGACTTTATTCTGG + Intergenic
917132873 1:171760540-171760562 ACTATTACCAGATTTCAGTCAGG + Intergenic
919169188 1:193932165-193932187 CTTATTACTAGATTTTAGCAAGG - Intergenic
921535689 1:216346182-216346204 CTTATTACCTGACTTTAGCCAGG - Intronic
922759628 1:228119345-228119367 CTTATTACCTGACTTTAGCCAGG + Intergenic
923274123 1:232382131-232382153 CTGAATACCAGGCTTTTGTCAGG + Intergenic
1066089593 10:32004445-32004467 CTTATTACCATCCTGTTGTCAGG - Intergenic
1066976950 10:42377868-42377890 TTTATCACCCGACTTTAGCCAGG + Intergenic
1068473470 10:57494987-57495009 CTTATTACCAGACTCTAGCTGGG - Intergenic
1077926762 11:6688945-6688967 CTTATTACCAGACTCTAGCCAGG - Intergenic
1079235390 11:18684992-18685014 CTTATTAGCAGACTCTAGCCAGG - Intergenic
1080028465 11:27636350-27636372 CTTATTACCAGACTCTAGTCAGG + Intergenic
1080058422 11:27931747-27931769 CTTATTACCCAACTTTAGCCAGG + Intergenic
1080288319 11:30641548-30641570 CTTTTTACCCAATTTTAGTCAGG - Intergenic
1081329879 11:41789789-41789811 CTTATTATCAGATTTTAGCCAGG - Intergenic
1082281108 11:50272226-50272248 GTTTTAACCAAACTTTAGTCAGG - Intergenic
1082942410 11:58721666-58721688 CTTATTACCATATTTCAGTTAGG + Intronic
1083001549 11:59296953-59296975 CTTATTACTTGACTTTAGCCAGG + Intergenic
1083011304 11:59402406-59402428 CTTAATACCCTACTTTAGCCAGG - Intergenic
1086508868 11:87533776-87533798 CTTACTATCAGATTTTAGTCAGG - Intergenic
1086989984 11:93292176-93292198 CTTTTGACCAAACTTGAGTCAGG - Intergenic
1087304127 11:96469188-96469210 CCTATTACGAGACTTTTGCCTGG + Intronic
1087524850 11:99296799-99296821 CTTATTACCCGATTTTAGCCAGG + Intronic
1089408930 11:118222003-118222025 TTTATTACCAGATTTTAGCCAGG - Intronic
1089940679 11:122413283-122413305 TTCATTACCAGATTTTAGTCAGG - Intergenic
1090055498 11:123420037-123420059 CTTGTTTCCAGAATGTAGTCAGG - Intergenic
1090488743 11:127139178-127139200 CTTGTCACCAGACTTCACTCTGG - Intergenic
1092653128 12:10655791-10655813 CTTATTACCTGACTTCAGCCAGG - Intronic
1093616486 12:21231873-21231895 CTTATTATCTGACTTTAGCAAGG + Intronic
1093920835 12:24857412-24857434 CTTATTATCAGACTCTAGCCAGG - Intronic
1094239906 12:28210672-28210694 TTTATTACCTGACTTTAGCCAGG + Intronic
1096905322 12:54930332-54930354 TTAATTACCAGACTTAGGTCAGG - Intergenic
1097157070 12:57020104-57020126 CTTGTTACCAGATTTTAGTTGGG - Intronic
1098502353 12:71207462-71207484 CTTATTACTTGACTTTACCCAGG - Intronic
1098744691 12:74220822-74220844 CTTATTATCAGGCTTCAGCCAGG - Intergenic
1100930982 12:99609251-99609273 CTTATTATCAGATTTCAGCCAGG + Intronic
1101290445 12:103362199-103362221 CTTATTACCAGCCTGGAGCCTGG + Intronic
1106340648 13:28823562-28823584 TTTTTGACCAAACTTTAGTCAGG + Intronic
1106439583 13:29754174-29754196 AGTATTACCAGACATTATTCCGG - Intergenic
1106499093 13:30309913-30309935 CTTCATACCAGACTTTGTTCCGG - Intergenic
1109345925 13:61114226-61114248 CTCATTACTTGACTTTAGCCAGG - Intergenic
1109406356 13:61905378-61905400 CTTATTATCAAACGTTAGCCAGG + Intergenic
1109945380 13:69424681-69424703 CTTATTACCAGAATTGTTTCTGG - Intergenic
1110049893 13:70883628-70883650 CTTATTACCCAATTTTAGCCAGG - Intergenic
1110392027 13:74984879-74984901 ATTCTTTCCAGACTTTATTCAGG + Intergenic
1110704767 13:78592864-78592886 CTTATTGCTAAACTTTATTCTGG - Intergenic
1111009335 13:82291754-82291776 TTTATTACCAGATTTTAACCAGG + Intergenic
1113524121 13:110960625-110960647 CTTATTACCCAACTTTAGCCAGG - Intergenic
1113700830 13:112386798-112386820 CTTATTACCTGACTTTAGCCAGG + Intronic
1113968691 13:114171490-114171512 CTTATTACCCGACTTTAGCCAGG + Intergenic
1116346773 14:43803633-43803655 CCCATTACCAGCCTTCAGTCTGG + Intergenic
1116678822 14:47939864-47939886 CTTATTACCCAATTTTAGCCAGG - Intergenic
1119667816 14:76497637-76497659 CCTATAACCAGAATTTTGTCAGG + Intronic
1120259346 14:82162157-82162179 CTTATTACCAGATTTTATCCAGG - Intergenic
1121610874 14:95278248-95278270 CTTATTCCCAAACTCTAGCCAGG - Intronic
1123477811 15:20603294-20603316 CTTATTACCAGGCTCTAGTGAGG - Intergenic
1123640204 15:22397088-22397110 CTTATTACCAGGCTCTAGTGAGG + Intergenic
1123771290 15:23531956-23531978 CTTATTACCAGACTCTAACTGGG + Intergenic
1124040119 15:26094213-26094235 CTTATTACCCTACTTTAGCCAGG + Intergenic
1124996929 15:34732553-34732575 CTTGCTTCCAGACTTTACTCAGG - Intergenic
1126673104 15:51134412-51134434 CCTTTGACCAGACTTTAGTGAGG + Intergenic
1127215403 15:56818263-56818285 TTCTTTACCAAACTTTAGTCAGG - Intronic
1128128952 15:65212730-65212752 CTTATTCCCAGGCTCTAGACTGG + Intergenic
1129677151 15:77637872-77637894 CTGATTAAGAGACTTCAGTCAGG - Intronic
1133260307 16:4545121-4545143 CTAATGACCAGACGTTAGTTGGG + Intergenic
1133764488 16:8828066-8828088 CTTATTACCAGACTCTAGCCAGG + Intronic
1135144820 16:19952151-19952173 TTTATTACCAGACTTTAGCCAGG - Intergenic
1135777598 16:25270524-25270546 CTCACTTCCAGAATTTAGTCAGG + Intergenic
1137330619 16:47491956-47491978 CTTAATACCTGACTTTAGCCAGG + Intronic
1137452698 16:48591516-48591538 CTTATTATCAGACTCTAGCCAGG - Intronic
1138626044 16:58252689-58252711 CTTATTACTAGAACTTACTCAGG + Intronic
1139014895 16:62677951-62677973 ATTATTACCTGCCTTTATTCTGG + Intergenic
1139205146 16:65021664-65021686 CTTAATACCAGACTCTAGGCAGG + Intronic
1140535997 16:75710278-75710300 CTTATTACCCTACTTTATCCAGG - Intronic
1145821629 17:27841073-27841095 CTTATTACCAGATTTTAGTGGGG - Intronic
1149472255 17:56926530-56926552 CTTATTACCATATTTCAGTGAGG - Intergenic
1152416087 17:80162957-80162979 CTTGTTACCAGATTTTAGCTGGG + Intergenic
1155713711 18:28913311-28913333 TTAATTACCAGATTTTAGCCAGG - Intergenic
1163999952 19:21089354-21089376 CTTATTACCAGACTTTAGTCAGG + Intronic
1164006158 19:21151387-21151409 CTTATTACCAGACTTTATTCAGG + Intronic
1164423462 19:28118524-28118546 CTTATTACCAGATGTTAGCTGGG + Intergenic
1165853232 19:38863535-38863557 CGTATTACCAGCTTTTAGTTGGG - Intergenic
1166900916 19:46062168-46062190 CTTATTACCCAACTTTAGCCAGG + Intronic
926521776 2:13924251-13924273 CTTATTACCTGACTTTAGCCAGG - Intergenic
928382278 2:30828851-30828873 CTTATTACCCTACTTTAACCAGG - Intergenic
928672274 2:33613735-33613757 CTTATTACCAGACTCTAGCCAGG - Intergenic
928931804 2:36632542-36632564 CTTATCACCAGACTCTAGCTGGG + Intronic
930118902 2:47743787-47743809 CTTATTATCAGATTTCAGCCAGG - Intronic
936033824 2:109093588-109093610 CTTATTACCAGACTCTAGCCAGG - Intergenic
937711670 2:124986537-124986559 TTTATTACCTAACTTTAGCCAGG - Intergenic
938106707 2:128536456-128536478 CTTATTACCAGATTTCACTCAGG - Intergenic
938700709 2:133876678-133876700 TTTATTACCAAACTCTAGCCAGG + Intergenic
938790603 2:134672450-134672472 CTTATTACTGCACTTTAGACTGG - Intronic
939091269 2:137782371-137782393 CTTATTAACAGACTGTAGCCAGG - Intergenic
940466662 2:154038100-154038122 CTTATTATCAGGCTGTAGTGAGG - Intronic
941531319 2:166674965-166674987 CTTATTACCTGACTTTAGCCAGG + Intergenic
942643811 2:178089675-178089697 CGTTTGACCAGACTTGAGTCAGG - Intronic
944520031 2:200556332-200556354 CTCATTACCTGATTTTAGCCAGG + Intronic
945464711 2:210154933-210154955 GTTATTACCAGATTATAGGCTGG - Intronic
945704481 2:213212610-213212632 CTTATTACCTGATTTTAGCCAGG + Intergenic
947203904 2:227642985-227643007 GTCTTGACCAGACTTTAGTCAGG - Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1171319081 20:24223217-24223239 CTTATTAACCCACTTTAGTCAGG + Intergenic
1173752102 20:45485459-45485481 CTTATTACCAGACTCTAGCCGGG + Intergenic
1174095374 20:48084917-48084939 TTTACTACCAGGCTTAAGTCAGG + Intergenic
1177532711 21:22383235-22383257 CATTTTACCAGATTTAAGTCAGG + Intergenic
1180242886 21:46523579-46523601 CTTATTACCCAACTTCAGCCAGG + Intronic
1183175030 22:36217105-36217127 CTTACTACCAGATGTTAGCCAGG - Intergenic
1183325868 22:37193595-37193617 CTTGTTACCAGACTCTAGCCGGG + Intronic
949990231 3:9572853-9572875 CATATTATCAGATTTTAGCCAGG - Intergenic
950921178 3:16696362-16696384 CTTATTACCAGATTTTAGCTGGG + Intergenic
952294653 3:32050626-32050648 CTTATTACCTGACTTTAGCCAGG - Intronic
952570561 3:34711404-34711426 CTTAATATCAGACTTTACTGTGG + Intergenic
952807562 3:37371117-37371139 ATTATTACCAGATTTTAGCCAGG - Intergenic
953153386 3:40345458-40345480 CTTATTACCTGACTTCAGGCAGG - Intergenic
953176679 3:40559854-40559876 CTTATTACCAGACTCTAGCCAGG + Intronic
953312625 3:41894322-41894344 TTTATTACCAGATTTTACTTTGG + Intronic
958033774 3:88147340-88147362 CTGTTTCCCATACTTTAGTCAGG - Intronic
958954178 3:100449797-100449819 CTTATTACCATATTTTAGTTAGG + Intronic
961338036 3:126196526-126196548 CTTATTACCTGACTTTAGCCAGG + Intronic
961510737 3:127401781-127401803 CTTATTACCCGACGTTAGCCAGG + Intergenic
961940808 3:130635995-130636017 CTTATTACCAGTGTTAAGTATGG - Intronic
963783234 3:149508151-149508173 GTCATGACCACACTTTAGTCAGG + Intergenic
963907527 3:150785172-150785194 CTTATGTCCATACTTTATTCAGG + Intergenic
964970262 3:162551746-162551768 CTTATTACCAGACTCCAGCCAGG + Intergenic
965151232 3:164978066-164978088 TTTATTTCCAGACTCTATTCTGG + Intergenic
965278910 3:166723364-166723386 CTTATTACTCGCCTTTAGCCAGG + Intergenic
965869326 3:173247753-173247775 CTTATTGCCAGACTCTAGCCAGG + Intergenic
966014173 3:175121114-175121136 CTTATTACTTGTCTTCAGTCAGG - Intronic
966859849 3:184224654-184224676 TTTTTTTCCAGACTATAGTCAGG + Intronic
967227070 3:187302229-187302251 CTAATAAACAGACTTTGGTCTGG - Intergenic
968699927 4:2050366-2050388 CTTATTATCAGATTTCAGTCAGG - Intergenic
968847332 4:3052301-3052323 CTTATTACCCAACTTTCATCAGG - Intergenic
973776027 4:54242441-54242463 CTTAATACCAGACTCTAGCCAGG - Intronic
975756231 4:77574053-77574075 CTAATTACCAGACTCTAGCTAGG - Intronic
977499893 4:97824999-97825021 CTTATTACCTGATTTTAGCCAGG - Intronic
981201072 4:141980006-141980028 CTTATTACCTGATTTTAGCCAGG - Intergenic
981456124 4:144954945-144954967 CTTATTATCTTACTTTAGCCAGG - Intergenic
981661616 4:147174055-147174077 CTTATCAACAGACTTCAGTGAGG - Intergenic
982415119 4:155121972-155121994 CTTATTAACATATTTTAGTTGGG + Intergenic
983410431 4:167389469-167389491 CTTGTGACTAGATTTTAGTCAGG + Intergenic
983658967 4:170112803-170112825 CTTATTATCAGATTTTAGTCAGG - Intergenic
984120974 4:175743293-175743315 CTAATTTCCAGACTTTATACTGG - Intronic
984305726 4:177987809-177987831 CTTATTTCAAGACTCTAATCTGG + Intronic
984987058 4:185341576-185341598 CTTCAGACAAGACTTTAGTCTGG - Intronic
985326338 4:188775515-188775537 CATATTACCAGAATTTTTTCTGG + Intergenic
985350973 4:189060781-189060803 GTTATTAACAGAGTTTAATCTGG - Intergenic
986403971 5:7407152-7407174 CTTGTTACCAGACCTTAGAATGG - Intronic
986920085 5:12669549-12669571 CTAATTTACAGACTTTATTCAGG + Intergenic
988568781 5:32343549-32343571 CTTATTGCCTGACTTTAGCCAGG - Intergenic
992232301 5:74675404-74675426 CTCTTGACCAAACTTTAGTCAGG - Intronic
993696753 5:91070756-91070778 ATTATTACCAGAGTTTAGATAGG - Intronic
995588488 5:113673939-113673961 ATGATTACCAGACATTATTCTGG + Intergenic
995600278 5:113788691-113788713 CTTATTACCAGATATTAGCTGGG + Intergenic
996057864 5:119000478-119000500 CTTATTACATGACTTTAGCCAGG + Intergenic
996594855 5:125188745-125188767 CGTATTACTAAACTTTAGTTAGG + Intergenic
997152113 5:131509189-131509211 CTAGTTACCATACTTTAGTTGGG - Intronic
997166320 5:131663189-131663211 TTTATTACCAGATTTCAGTGAGG - Intronic
998793841 5:145795632-145795654 TTTATTTCCAGATTTTACTCAGG - Intronic
1000251392 5:159498949-159498971 CCTACTCCCAGGCTTTAGTCTGG - Intergenic
1000477743 5:161732259-161732281 GTTATTACCAGATTTTAGCTGGG - Intergenic
1002944240 6:1745696-1745718 CTCATTCCCAGACTGGAGTCTGG - Intronic
1003054554 6:2806470-2806492 ATTATTACCAGACATTATTGCGG + Intergenic
1004765640 6:18723202-18723224 CTTATTACCTGACTTTAGCCAGG - Intergenic
1005239895 6:23812098-23812120 AATATTACTAGACTTTATTCTGG - Intergenic
1006037021 6:31221939-31221961 CTTATTACCAGATTTTAGCCAGG + Intergenic
1006290934 6:33136151-33136173 CTTATTACTTGACTTTAGCCAGG + Intergenic
1007846550 6:44762683-44762705 CTTATTATCAGATTTTAGCCAGG + Intergenic
1008334142 6:50279856-50279878 TCTATGACCAAACTTTAGTCAGG - Intergenic
1009716768 6:67407297-67407319 CTTATTACCTGACTGTAGCCAGG - Intergenic
1010851920 6:80787665-80787687 CTTATTTTCAGACTTTGCTCTGG + Intergenic
1012200989 6:96405795-96405817 CTTATTACCAGACTCTAGTTAGG - Intergenic
1013473973 6:110490228-110490250 CGTATTACCAGACTTTAGCCAGG - Intergenic
1014111657 6:117624317-117624339 CTTATTACCTAACTTTAGCCAGG - Intergenic
1015949766 6:138540397-138540419 CTTATTACCAGATTTAAGAAGGG + Intronic
1016296201 6:142575707-142575729 CTTATTACCCAAATTTAGCCAGG - Intergenic
1018189311 6:161294757-161294779 CTTATGATCAGACTCTAGTCAGG - Intergenic
1018193336 6:161330764-161330786 CTTATTACCATATTTTAGCTGGG - Intergenic
1018801896 6:167229220-167229242 CTTATTACCCGACTTTAGCCAGG - Intergenic
1020737051 7:11964004-11964026 CTTATTATCAGATTTTAGCTGGG + Intergenic
1020961665 7:14812287-14812309 TTTATTACCTGTCTTTAGTTTGG + Intronic
1021215293 7:17908817-17908839 GTTATTACAAGACTTTAGGAAGG + Intronic
1022747085 7:33183487-33183509 CTTATTACCCTACTTTAACCAGG + Intronic
1024146786 7:46524831-46524853 CTTGTTACCTGACTCTAGCCAGG - Intergenic
1029811067 7:103049756-103049778 CTTATTACCCGACTTTAGCCAGG + Intronic
1029859562 7:103554892-103554914 CTTAGCACCATACTTCAGTCAGG + Intronic
1029869175 7:103670945-103670967 CTTATAGCCAGGCTTTATTCTGG - Intronic
1033052472 7:138018567-138018589 CTTATTACCAGATTCTAGGTGGG - Intronic
1035810832 8:2489654-2489676 TTTATTCCCTGACTTTACTCAGG - Intergenic
1036736791 8:11326256-11326278 CTTATTATCCGACCTTAATCTGG + Exonic
1037145396 8:15565721-15565743 CTTTGTATCAGACTTCAGTCAGG - Intronic
1040089718 8:43385414-43385436 CTTATTACCTGACTTTACCTAGG + Intergenic
1040418251 8:47215507-47215529 CTTAATACCAGACTCTATCCAGG + Intergenic
1040755314 8:50766257-50766279 CTCTTTACCAGACTTTAGATAGG + Intronic
1041226065 8:55699366-55699388 CTTATTACCAGATTTTAGCCAGG - Intronic
1041228788 8:55728607-55728629 CTTATTACTAGACTCTAGTAAGG + Intronic
1041230678 8:55748065-55748087 CATATTCCCAGACTATAGTGAGG - Intronic
1042442709 8:68846634-68846656 TTTATTACCAGATTTTAGTGAGG - Intergenic
1044439586 8:92208035-92208057 CTTATTACCCGACTTTAGCCAGG + Intergenic
1047229342 8:122982868-122982890 TTTCTTACCAGATTTGAGTCAGG - Intergenic
1047363995 8:124195565-124195587 CTGATTGCCAGAGTTTAGGCTGG + Intergenic
1048959745 8:139566444-139566466 CTTATTAACAAATTTTAATCTGG + Intergenic
1050657896 9:7848932-7848954 CTTATTACCTGATTTTAGCCAGG - Intronic
1050658341 9:7854237-7854259 CTTTTGACCAAACTTGAGTCAGG - Intronic
1053401092 9:37823527-37823549 CTAATTACAATTCTTTAGTCTGG - Intronic
1055970853 9:81911421-81911443 CTTATTACCTTATTTTAGCCAGG + Intergenic
1056565330 9:87767075-87767097 TGTTTGACCAGACTTTAGTCAGG - Intergenic
1056728181 9:89141017-89141039 CTTATTACCAGACTTTAGCCAGG + Intronic
1056746691 9:89309879-89309901 CTTACTTCCAGCCTCTAGTCTGG + Intergenic
1058015898 9:100031646-100031668 CTTATTATCTGACTTTAGCCAGG - Intronic
1058355762 9:104082063-104082085 CTCATTATCAGACTCTAGCCAGG + Intergenic
1062251529 9:135598295-135598317 CTTATTAACAGATTTTAGCCAGG - Intergenic
1187936825 X:24344457-24344479 CTTATTACCTGACTTTAGCCAGG + Intergenic
1189863832 X:45302046-45302068 CTTATTACCATATTTTAGCTGGG - Intergenic
1190175556 X:48146274-48146296 CCTTTGACCAGACTTGAGTCGGG + Intergenic
1190195722 X:48316768-48316790 CCTTTGACCAGACTTGAGTCGGG + Intergenic
1190478210 X:50849063-50849085 TTTATTGCCAGACTCTAGCCAGG + Intergenic
1190591815 X:52010520-52010542 CTTATTATCAGATTTTAGCCAGG - Intergenic
1190957024 X:55205983-55206005 TTTATTACCAGATTTCAGCCAGG + Intronic
1191613084 X:63137377-63137399 CTTATTACCCAAATTTAGCCAGG - Intergenic
1191623213 X:63241549-63241571 CTTATTACCCAAATTTAGCCAGG + Intergenic
1192714384 X:73624422-73624444 CTTATTACCTGACATTAGCCAGG + Intronic
1192888590 X:75363658-75363680 CTTATTACCCAACTTTTGCCAGG - Intergenic
1193287335 X:79727775-79727797 CTTATTACAAGATTTTAGCTGGG - Intergenic
1193486428 X:82089809-82089831 CTTATTACCTGACTTTAGCCTGG - Intergenic
1194086142 X:89531442-89531464 CTTATTACCCTACTTTAGCCAGG + Intergenic
1194187794 X:90794593-90794615 CTTATTACCCTACTTTAGCCAGG - Intergenic
1194576478 X:95619753-95619775 CTTATTATCAGATTTTAGGGAGG + Intergenic
1194577405 X:95629301-95629323 CTTATTACTAGACTCTAGCAAGG - Intergenic
1195559004 X:106262018-106262040 CTTATTAACCTACTTTAGCCAGG + Intergenic
1196832011 X:119783151-119783173 TGTATCACCAGACTATAGTCTGG - Intergenic
1199994650 X:153014197-153014219 CTTATTACCCAACTTTAGCCAGG + Intergenic
1200438800 Y:3187314-3187336 CTTATTACCCTACTTTAGCCAGG + Intergenic
1200534380 Y:4376545-4376567 CTTATTACCCTACTTTAGCCAGG - Intergenic