ID: 1164001230

View in Genome Browser
Species Human (GRCh38)
Location 19:21101311-21101333
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 5, 1: 10, 2: 18, 3: 32, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164001224_1164001230 -4 Left 1164001224 19:21101292-21101314 CCTAGGGTGATGGGATGCCCTCT 0: 2
1: 4
2: 19
3: 12
4: 173
Right 1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG 0: 5
1: 10
2: 18
3: 32
4: 239
1164001223_1164001230 -3 Left 1164001223 19:21101291-21101313 CCCTAGGGTGATGGGATGCCCTC 0: 1
1: 8
2: 7
3: 25
4: 92
Right 1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG 0: 5
1: 10
2: 18
3: 32
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902987779 1:20165897-20165919 CTCAGGGTTGGCAGTGAGGAGGG + Intronic
904420806 1:30389960-30389982 CTCTGGGTTTGTCTAGAATAAGG + Intergenic
908267133 1:62390447-62390469 GTCTGAGTTTTCAGTGAAGAAGG - Intergenic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
909691015 1:78408184-78408206 CCCTATGTTTGTAGTTAAGAAGG - Intronic
910369800 1:86503596-86503618 TTCTGGGTTTGTGGTGATGGAGG + Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914422476 1:147541875-147541897 CTCTGGGTTGGTGGGGGAGAAGG + Intronic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
916015464 1:160745649-160745671 CTCAGCCTTTGTAGTGAAAAAGG + Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
919811020 1:201408871-201408893 AACTGGGTTTTTAATGAAGAAGG + Exonic
921596955 1:217064909-217064931 CTCTGGGCTTTTAATGAGGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1072899361 10:99393752-99393774 CTCTGGGTTGTTGGGGAAGAGGG - Exonic
1074047140 10:109849616-109849638 CTATGGGATTGTTGTAAAGATGG - Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076727366 10:132419862-132419884 CCCAGGGTTTGTCGTGGAGAGGG + Intergenic
1078600275 11:12724473-12724495 CTTTATGTTTGTAATGAAGAGGG + Intronic
1079231842 11:18655850-18655872 TTTTGGATTTTTAGTGAAGATGG - Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083465163 11:62840753-62840775 TTTTGGTTTTTTAGTGAAGACGG + Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1088790276 11:113219286-113219308 CCCTGGGTTTGTACTGAATGAGG - Intronic
1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG + Intergenic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092901601 12:13064873-13064895 ATCTGGGTTTAGAGTGAAGTGGG + Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1094360591 12:29626613-29626635 CTTTGGGTGTGCAGTGAAGTAGG - Intronic
1095959556 12:47825618-47825640 CTCAGGGTTGGGAGTGAAGCTGG - Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1103766769 12:123285833-123285855 CTCTGTATTTTTAGTAAAGATGG - Intergenic
1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG + Intergenic
1107114859 13:36735565-36735587 CTTTGTGTTTGTAGTACAGAGGG + Intergenic
1107511321 13:41088337-41088359 TTCTAGGCTTGAAGTGAAGATGG - Intergenic
1107517354 13:41143758-41143780 CTTTGGGTTTATAGTCAAGTTGG - Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG + Intronic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1113732683 13:112653278-112653300 CTCTGCGTTTGTAATGGAAAGGG - Intronic
1113959171 13:114116317-114116339 CTCTAGGTTAATAGTGAGGACGG - Intronic
1114966341 14:27965846-27965868 CTGTGGGTTTTTAGAGAATATGG + Intergenic
1115010796 14:28542280-28542302 CTCTGCCTTTGTAGTGTAAAAGG - Intergenic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118867028 14:69712003-69712025 TTCTGGGTTTGTGGTGACGGAGG + Exonic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1127292411 15:57582189-57582211 CTCTGAGGTTGCAGTGAAGCAGG + Intergenic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129457759 15:75684742-75684764 GCCTGTGTTTGTAGTGAGGATGG + Exonic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1138136552 16:54528369-54528391 CTCTGGGTTTTTAGTCCATATGG - Intergenic
1138387813 16:56648138-56648160 CTCTGGCTTTGTAGTTAGGGTGG - Intronic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1141086345 16:81098163-81098185 CTTTGGATTTGTAGTAGAGACGG - Intergenic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG + Intergenic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1147743340 17:42680917-42680939 CTCAAGGTTTGCTGTGAAGATGG + Intronic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1150505894 17:65698873-65698895 CCCTGGGCTTGCACTGAAGAGGG - Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1152926219 17:83088987-83089009 CTCTGGGCTTGTGGAGAGGAAGG + Intronic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1158118958 18:54026875-54026897 TGCTGGGTTTGTAGGGAAGTAGG + Intergenic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1161953368 19:7479624-7479646 CTCTGGATTTGCAGTGAGCAGGG - Intronic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1162942730 19:14023159-14023181 CTCTGAGTTCATTGTGAAGATGG - Intergenic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163873560 19:19846240-19846262 CTCTGAATTGGTAGTGGAGAGGG - Intergenic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163901640 19:20106820-20106842 CTCTGAATTGATAGTGAAGAGGG + Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166168893 19:41012949-41012971 TTATAGGGTTGTAGTGAAGATGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166545219 19:43630454-43630476 CTTTGTGTTTTTAGTAAAGACGG + Intronic
927457023 2:23261680-23261702 ATCTGTGTTTGGAGTGAAGGTGG + Intergenic
927615871 2:24594585-24594607 CTTTTGGTTTGTTGTGCAGATGG + Intronic
928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG + Intronic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
931775975 2:65540743-65540765 CTGTGGCTTGGTAGTGAAAAAGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933188073 2:79301246-79301268 CTCTGCCTTCGTAGTGTAGAAGG - Intronic
934151733 2:89153999-89154021 CTCAGGCTGTGTAGTGATGAAGG - Intergenic
934215527 2:90027907-90027929 CTCAGGCTGTGTAGTGATGAAGG + Intergenic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
938169895 2:129066010-129066032 CTGGAAGTTTGTAGTGAAGAAGG - Intergenic
939895670 2:147788194-147788216 ATCTAGGTTTGTAGTTAAAAAGG - Intergenic
940035569 2:149309320-149309342 CTCTCTGTTTGTAGTCAAGTTGG - Intergenic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
942338474 2:174917019-174917041 CTTTGTGTTTTTAGTGGAGATGG - Intronic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
945285660 2:208078851-208078873 CTCTGGGCTGGTACTGAGGAGGG - Intergenic
945414898 2:209558952-209558974 CTCTGCCTCTGTAATGAAGAAGG + Intronic
945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG + Intergenic
1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG + Intronic
1172233269 20:33351576-33351598 CTCTGTTGTTGTAGTAAAGATGG + Intergenic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1173959487 20:47059957-47059979 AACTGTGTTTGTAGTGTAGAGGG - Intronic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1185323854 22:50216126-50216148 CTCTGGGTTTCTAGGGAGAATGG + Intronic
949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG + Intronic
952828381 3:37542922-37542944 CTCTGGGTCTGCAGTGATGCTGG + Intronic
953669556 3:44951318-44951340 CTCTGAGTTTTCAGTGCAGAAGG + Intronic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956090395 3:65660302-65660324 CTCTGAGTTTATAGTCAAAAAGG + Intronic
956149081 3:66222350-66222372 TTTTGGGTTTTTAGTGGAGACGG + Intronic
956875026 3:73454227-73454249 CTCTGGGTTTGTATAGATGGTGG - Intronic
959712715 3:109401023-109401045 CTTTGTGTTTTTAGTGGAGATGG + Intergenic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
962198536 3:133382732-133382754 CTCTGGGTTGTTAGTGCAGGAGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
963371289 3:144403874-144403896 CTCTGGGTAAGAAGTGAATATGG + Intergenic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
964437275 3:156667399-156667421 CTCTGTTTTTATAGTAAAGAAGG - Intergenic
965062138 3:163797509-163797531 CTTTGTATTTTTAGTGAAGATGG + Intergenic
966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG + Intergenic
966610955 3:181867618-181867640 CTCTGGGTTTCTAGTCATGAGGG - Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG + Intergenic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968792214 4:2673660-2673682 CTCTGGGTGTAAAGTGAGGAAGG + Intronic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971295597 4:25387194-25387216 CACCAGGGTTGTAGTGAAGAAGG + Intronic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
971959509 4:33467534-33467556 ATCTGGGCTTGTTGTGAAGTGGG - Intergenic
972011448 4:34188393-34188415 CTCGGGGTCTGTAAAGAAGAAGG + Intergenic
972170697 4:36342227-36342249 CTCTGGGTTGAAAGTGATGATGG + Intronic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
973774937 4:54233676-54233698 CTCTGGGTTTGGATTGAGAATGG + Intronic
974388953 4:61239597-61239619 CTCTGTGTTTGTATTTAAGTGGG - Intronic
976654703 4:87476481-87476503 CCCTGGGTTTGTATTTAAGATGG - Intronic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
978008602 4:103651326-103651348 CTCTGCCTTTGAAATGAAGACGG - Intronic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980654643 4:135766209-135766231 CTCTGGGTCTGTAATGTAGCAGG + Intergenic
981683280 4:147424534-147424556 CTCTGGGTTTGTTATATAGAAGG + Intergenic
982622318 4:157723871-157723893 CTCTGGGTTTGTGATGGAGGGGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986748991 5:10768719-10768741 CACAGGCTTTGAAGTGAAGAAGG + Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
987849068 5:23325434-23325456 CTTTGGGTTTCTAGAGAATAAGG - Intergenic
991620941 5:68544984-68545006 GTCAGTGTGTGTAGTGAAGATGG - Intergenic
992426151 5:76659750-76659772 CTCTTGGTTTCTAGTGAGCAGGG - Intronic
993360881 5:86974885-86974907 CTGTGAATTTGTAGTGAATAAGG - Intergenic
994921313 5:106047876-106047898 CACTGTGGTTGTAGTGAAGTAGG - Intergenic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
1000524427 5:162339016-162339038 CTCTTGGTATGTGGAGAAGACGG - Intergenic
1000833829 5:166132490-166132512 TTCTGGGTTTTTAATAAAGAGGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1006326279 6:33356394-33356416 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1013353281 6:109325182-109325204 CTCTGGGCTTATTGTGAAGTAGG + Intergenic
1013810472 6:114039482-114039504 CTCTGGCTTTGAAGTAAGGAAGG - Intergenic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1016725197 6:147357165-147357187 CTATAGGTATGTAGTCAAGAGGG + Intronic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1032790438 7:135238498-135238520 CTCTGGGCTTGTAGGGAATCTGG - Intronic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1035876075 8:3191052-3191074 CACTGTGTTTATAGTTAAGAGGG + Intronic
1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG + Intergenic
1039776158 8:40738987-40739009 CTCAGGGGTTCTAGTAAAGAGGG - Intronic
1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG + Intergenic
1040629711 8:49196404-49196426 CTTTGGGTTTGTAATCAGGAGGG + Intergenic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1042497905 8:69476211-69476233 ATTTGTCTTTGTAGTGAAGAAGG - Intronic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG + Intergenic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1046735643 8:117773832-117773854 CTTTTGGTTTTTATTGAAGAAGG - Intergenic
1048620590 8:136128609-136128631 CTTTGTTTTTGTAGTAAAGATGG + Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1050067197 9:1772118-1772140 CTCTGGGTTTATGATGAAAATGG + Intergenic
1052512310 9:29437620-29437642 CTCTGTGTGTGTATTGCAGAGGG - Intergenic
1052682997 9:31718009-31718031 CACTGGTTTTATAGTGATGAAGG - Intergenic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1056239581 9:84631153-84631175 GTCTGGGTTTTCAGTGAAGCAGG + Intergenic
1056696277 9:88856739-88856761 CTCTGGATTGGTACTGAGGAGGG - Intergenic
1057973032 9:99575604-99575626 CCCTGGGTTTATATGGAAGAAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062405265 9:136393220-136393242 GTCAGGGTTTGCAGTGATGACGG - Intronic
1185569729 X:1124339-1124361 CCCTGCGTTTGCAGCGAAGATGG - Intergenic
1188187551 X:27133235-27133257 CTCTGGGTTATTACTGGAGAAGG - Intergenic
1190497314 X:51039339-51039361 TCCAGGGTTTATAGTGAAGATGG - Intergenic
1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG + Intergenic
1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1192519103 X:71783155-71783177 TTCTGGGTTTGTGGTGACGGAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1194024592 X:88736055-88736077 GTCTGGGTGTGTAGCAAAGAGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1197050070 X:122046966-122046988 ACCTGGCTTTGTAGTGAACAGGG - Intergenic
1198036504 X:132806085-132806107 CTCTGGGTTGGTTGTGAATGTGG - Intronic
1198683824 X:139207011-139207033 CCTTGGGGTTGTTGTGAAGATGG - Intronic
1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG + Intronic