ID: 1164004415

View in Genome Browser
Species Human (GRCh38)
Location 19:21135567-21135589
Sequence AAACCTGGAAGTCGCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164004408_1164004415 16 Left 1164004408 19:21135528-21135550 CCTGGAACTCAAGCTGCAGTGAG No data
Right 1164004415 19:21135567-21135589 AAACCTGGAAGTCGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164004415 Original CRISPR AAACCTGGAAGTCGCCCTGC TGG Intergenic