ID: 1164006626

View in Genome Browser
Species Human (GRCh38)
Location 19:21155791-21155813
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 6, 1: 9, 2: 13, 3: 32, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902911786 1:19603874-19603896 TCCAGGAAACTCTCCAGCTTTGG - Intronic
904848796 1:33441289-33441311 ATTGGCAAACACTACAGATTTGG - Intergenic
905820394 1:40985614-40985636 TTCAGCAACCTCTCCAAATTTGG - Intronic
906900551 1:49831485-49831507 TTCAGCAAACTAAGGAGATTTGG + Intronic
908990248 1:70078447-70078469 ATCAGCAAACACTCCAAATTAGG + Intronic
912367025 1:109142412-109142434 TTCAGCAAACACTATAAATCAGG - Intronic
913536727 1:119780118-119780140 ATCAGCAAACACTACAAATCAGG - Intergenic
914779871 1:150775630-150775652 ATAAGCAAACTCTACAAATCAGG + Intergenic
916618471 1:166470272-166470294 CTCAGCAAACACTACAAATCAGG - Intergenic
917297812 1:173540144-173540166 TCCAGCCAACTATACAGAATAGG + Intronic
917755848 1:178097121-178097143 TTCAGGGAAATCTACAAATTGGG + Intronic
917900314 1:179536158-179536180 ATCAGCAGACTAAACAGATTGGG - Intronic
920383014 1:205546718-205546740 TTCAGCATTATCTCCAGATTAGG - Intergenic
922318154 1:224460602-224460624 TTAAACAAACTGTACAGATGTGG - Intronic
924770248 1:247073637-247073659 TTCAGCAAAGTCCACACATTTGG - Intronic
924786876 1:247207150-247207172 TTCAGCAAACTCCACACATTTGG - Intergenic
1066975278 10:42362508-42362530 TTCAGGAAATTCTACAAATTAGG - Intergenic
1067214039 10:44285656-44285678 TTCAGGAAACTCCGCAGGTTTGG - Intergenic
1068548737 10:58383199-58383221 CTCAGCAAACACCACAAATTGGG + Intergenic
1070197089 10:74168174-74168196 TACAGGAGACACTACAGATTTGG - Intronic
1070234708 10:74611333-74611355 TTCAGAAAAGTCTACAATTTAGG - Intronic
1070431432 10:76342996-76343018 ATCAGCAAACAGTACAGATCAGG - Intronic
1070646622 10:78206186-78206208 ATCAGGAAACTATACAGGTTTGG + Intergenic
1071877675 10:89860237-89860259 ATCAGCAAACACTACAAATAAGG - Intergenic
1075586734 10:123664015-123664037 ATCAGCAAACTCCATAGATCAGG - Intergenic
1075827779 10:125374634-125374656 GTCAGCAAACACTACAAATCAGG - Intergenic
1077845778 11:6023185-6023207 TTAAGCAAACTCTTCATAGTTGG - Intergenic
1078844505 11:15109146-15109168 TTGAGCAAACGCTATAAATTAGG - Intergenic
1078864351 11:15282609-15282631 ATCTGAAAAATCTACAGATTAGG + Intergenic
1079028953 11:16971476-16971498 TTCAGCAACCTTTCCAGGTTAGG + Intronic
1080273535 11:30476796-30476818 TTCAGCTCAATCTACTGATTGGG - Intronic
1080381039 11:31772503-31772525 TTCAGAGAACTCCAAAGATTAGG - Intronic
1080992716 11:37558772-37558794 TTCCCCAAATTCTATAGATTGGG - Intergenic
1084479520 11:69410653-69410675 TTCAGCAAAGCCTACAGAAAGGG - Intergenic
1087618281 11:100513848-100513870 TTCACTAAACTCTTCAAATTTGG - Intergenic
1088731548 11:112688320-112688342 TTCTCCAAACTCTACAACTTAGG + Intergenic
1088983499 11:114885493-114885515 GTTAGCAAACTCTACAAATCAGG - Intergenic
1089241725 11:117087067-117087089 TTCAGCAATTTCTCCAGTTTGGG + Intronic
1089743851 11:120603402-120603424 GTCAGCAAACACTACAAATCAGG + Intronic
1090063890 11:123487286-123487308 TCCAGAAAACTCTACAGAGGGGG + Intergenic
1091842787 12:3632698-3632720 TTCAGCACAGTCGACAGATCAGG - Intronic
1093157690 12:15707354-15707376 GTCAGCAAACTCTAGCCATTGGG - Intronic
1094094423 12:26687870-26687892 TTCAGCAAACTCTCCACAAAGGG + Intronic
1095690436 12:45082508-45082530 TTTAGCAAACTCTACATAGGTGG - Intergenic
1096480883 12:51940181-51940203 TGCAGAAAGCTCTACACATTTGG + Intergenic
1096558779 12:52421356-52421378 TTCTTCAAACTCTGCAGATAAGG - Intergenic
1099316957 12:81096009-81096031 TCCAGGAAACTCTCCAAATTGGG - Intronic
1100625045 12:96322549-96322571 GTCAGAAAACACTACAGATCAGG - Intronic
1102360627 12:112284665-112284687 TTCAGCACACTCTAATGAGTCGG + Intronic
1103243281 12:119433119-119433141 ATCAGCAAACACTACAAATCAGG + Intronic
1103742321 12:123099215-123099237 TTCAGCAAAATCGACAGTTCTGG - Intronic
1104044734 12:125153777-125153799 TTCTGCAAAGTCTACAGTGTGGG + Intergenic
1104351888 12:128051377-128051399 ATAGGCAAACACTACAGATTGGG + Intergenic
1104396851 12:128441459-128441481 TTCAGCCAAAGCTGCAGATTTGG - Intronic
1105942297 13:25158931-25158953 TTCAGCAAAATCTAGTGATCAGG - Intergenic
1107753845 13:43598174-43598196 ATCAGCAAACACTACAAAATAGG + Intronic
1109110211 13:58308136-58308158 ACCAGCCCACTCTACAGATTTGG + Intergenic
1111148903 13:84222331-84222353 TGCAGCAAACTATATGGATTTGG + Intergenic
1111277636 13:85971772-85971794 TTCAGGAAAATACACAGATTTGG - Intergenic
1112170779 13:96969784-96969806 TTCAGTTAAATCTACATATTAGG - Intergenic
1113331196 13:109329506-109329528 TTCAGCAAACAGCACAGATGAGG + Intergenic
1115432265 14:33333003-33333025 TGCAGCAAAATGTACAGATTTGG + Intronic
1116582104 14:46654769-46654791 ATCAGCAAACACTACAAATCAGG - Intergenic
1120311569 14:82834487-82834509 TTAAGCAAAAGCTACAGCTTAGG - Intergenic
1120657000 14:87202791-87202813 TACTGCAAACTTTACAGAATAGG + Intergenic
1120908456 14:89642657-89642679 TTCAGCAAATTCTCTACATTTGG + Intronic
1121542739 14:94740888-94740910 TTCAGCACACACTACAAATCAGG + Intergenic
1123798311 15:23796014-23796036 TTCAGCATGGTATACAGATTTGG + Intergenic
1124443728 15:29709661-29709683 TTCAGCAAACTCTGAATATAGGG + Intronic
1126425853 15:48526450-48526472 TTTACCAAATTCAACAGATTAGG + Intronic
1127152463 15:56091399-56091421 TGCAGCAAACTCTTTAAATTTGG - Exonic
1127682436 15:61310832-61310854 ATCAGCAAACACTACACATCTGG - Intergenic
1127720233 15:61692025-61692047 TTCAGCTAACCCTACACATGGGG + Intergenic
1129809244 15:78494219-78494241 TTCAGGAAACTCCAGAGACTGGG + Exonic
1134777232 16:16863755-16863777 TTCAGCAGAATCTGCAGAATTGG + Intergenic
1137007808 16:35294753-35294775 TTCAACAAACTCCATATATTTGG - Intergenic
1137038255 16:35585952-35585974 TTCAGCAAACTCTACAGATTTGG - Intergenic
1137928605 16:52565257-52565279 ATCGGCAAACACTACAAATTGGG - Intergenic
1138233494 16:55358889-55358911 TTCAGCAAACACTAGAAATCAGG - Intergenic
1138869626 16:60866622-60866644 TCCATCAAACTCTACAGTTGTGG - Intergenic
1139006660 16:62580260-62580282 TTCCCCTAACTGTACAGATTTGG + Intergenic
1140244639 16:73237071-73237093 TTTAGCTAACTTTACAGATGAGG + Intergenic
1143423137 17:6811883-6811905 ATCGGCAAATTCTACAGATTAGG - Intronic
1143841886 17:9738876-9738898 ATCAGCAAACGTTACAAATTAGG + Intergenic
1144250177 17:13408426-13408448 TTGATCAAACACTACATATTAGG + Intergenic
1145062312 17:19741006-19741028 TTAACCAACTTCTACAGATTTGG - Intronic
1148099370 17:45079018-45079040 TTTAGCTGATTCTACAGATTAGG + Intronic
1149616202 17:58002309-58002331 TTCATTAAAATCTACCGATTGGG + Intronic
1150832013 17:68530886-68530908 CTCATTAAACTCTAAAGATTAGG + Exonic
1150917459 17:69451307-69451329 ATCAGCAAATGCTACACATTAGG + Intronic
1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG + Intergenic
1155899758 18:31374424-31374446 TTCAGTAAACTCTAAAGTATGGG + Intergenic
1158387384 18:57010905-57010927 TACAGCAAACTCTAAAAAATAGG - Intronic
1159983681 18:74816717-74816739 TTCAGCAATTTATACAGATTAGG - Intronic
1162592647 19:11602726-11602748 TTCAGCAAACACCACACATTTGG + Intronic
1162624574 19:11874396-11874418 TTCAGCAAGCACCACACATTTGG + Intronic
1163141756 19:15354257-15354279 TTCAGCAAGGACTAAAGATTGGG + Exonic
1163870290 19:19815594-19815616 TTCAGCAGACTCTACAGATATGG - Intronic
1163898576 19:20080870-20080892 TTCAGCAAACTCTGCAGATTTGG + Intronic
1163904883 19:20143674-20143696 TTCAGCAAATGCTACAGATTTGG - Intergenic
1163908875 19:20171127-20171149 TTCAGCAAACTCTACAGATATGG + Intronic
1163913338 19:20215875-20215897 TTCAGCAAATGCTACAGATTTGG - Intergenic
1163924524 19:20327238-20327260 TTCTGTAAACTTTACAGAGTCGG + Intergenic
1163933466 19:20421120-20421142 CTCAGCAAACTCTACAGATTTGG - Intergenic
1163948370 19:20561627-20561649 TTCAGCAAACTCTACAGATTTGG - Intronic
1163957589 19:20658675-20658697 TTCAGCAAACTCTATAGATTTGG - Intronic
1163959120 19:20670848-20670870 TTCAGAAAACTCTACAGATTTGG + Intronic
1163969734 19:20780657-20780679 TTCAGCTAACTCTACAGATTTGG + Intronic
1164000257 19:21092004-21092026 TTAAGCTAACTCTACAGATTTGG + Intronic
1164006626 19:21155791-21155813 TTCAGCAAACTCTACAGATTTGG + Intronic
1164017729 19:21267504-21267526 TTCAGCAAACTCTACAGATTTGG - Intronic
1164027647 19:21367530-21367552 TTCAGCAAATGCTACAGATTTGG + Intronic
1164043545 19:21513609-21513631 TTAAGCAAACTCTACAGATTTGG + Intronic
1164048516 19:21563672-21563694 TACAGCTAACTCTACACATTTGG - Intergenic
1164070017 19:21758972-21758994 TTCAGCAAACTCTGCAGTTTTGG - Intronic
1164095415 19:22005472-22005494 TTCATCAAACTCTGCAGATTTGG - Intronic
1164101507 19:22058585-22058607 TTCAGCAAACTCTACAGATTTGG + Intronic
1164114899 19:22210204-22210226 TTCATCAAACTCTGCAGATTTGG - Intergenic
1164123707 19:22291145-22291167 TTTACCAAGCTCTACAAATTTGG + Intronic
1164136139 19:22418042-22418064 TTCAGCAAACTCTACAGATTTGG - Intronic
1164176327 19:22778354-22778376 TTTAGCAAACTCTACAAATTTGG - Intronic
1164241089 19:23389731-23389753 TTTAGCAAACTCTACAGATTTGG - Intronic
1164272066 19:23681554-23681576 TTCAGTAAACTCTACAGATTTGG - Intronic
1165158570 19:33802824-33802846 TTCAGGAAACTCTTCAGAGAGGG - Intronic
1166175677 19:41067775-41067797 ATCAGAAAACTCTACAAATGAGG + Intergenic
1166619010 19:44278766-44278788 TTAAATAAACTCTGCAGATTAGG + Intronic
925693087 2:6545524-6545546 TTTAGCAAACTCTAGAGAACTGG + Intergenic
926816013 2:16798147-16798169 TTGAGCAAATTTTACAGATGGGG - Intergenic
931013410 2:57945494-57945516 CTCAGCAAACTTTACAGGTATGG - Intronic
933968208 2:87447910-87447932 ATCAGCAAACACTACAAATCAGG + Intergenic
936325589 2:111502594-111502616 ATCAGCAAACACTACAAATTAGG - Intergenic
937440351 2:121909933-121909955 GTCAGCAAACTCTGGAGAATGGG + Intergenic
939708542 2:145485579-145485601 TTTAACTAACTCTACATATTGGG + Intergenic
939851072 2:147305603-147305625 ATCAGCAAACTCTACAAATCAGG + Intergenic
943122396 2:183753054-183753076 TTCAGGAAAGTCTACTTATTGGG - Intergenic
945414453 2:209553878-209553900 ATCCGCTAACTCTACAAATTAGG - Intronic
945730693 2:213529326-213529348 ATCAGCAAATTCTACAAATCAGG - Intronic
946436226 2:219657459-219657481 ATCAGCAGACACTACAAATTAGG + Intergenic
946887799 2:224241547-224241569 GTCAGCAAACATTACAGATCAGG + Intergenic
947267389 2:228298782-228298804 TTCAGCTGAGTCTACAGAATAGG - Intergenic
947806757 2:232974069-232974091 TTCAGAAAACTTTACAAATGGGG - Intronic
947930106 2:233957812-233957834 ATCAGCAAACACTACAAATTAGG + Intronic
1169566268 20:6856728-6856750 ATCAGCCAACACTACAAATTAGG - Intergenic
1170196354 20:13693296-13693318 ATCAGCAAACACTACAAATCAGG + Intergenic
1170535174 20:17334120-17334142 CCCAGCATACTCTCCAGATTGGG + Intronic
1170645244 20:18191781-18191803 ATCAGCAAACACTACACATCAGG - Intergenic
1172404648 20:34678783-34678805 ATCAGCAAACACTACAAATCAGG + Intergenic
1178527938 21:33348261-33348283 ATCAGCAAACACTACAAAATAGG - Intronic
1179035882 21:37758460-37758482 ATCAGCAAACACTACAAATGAGG - Intronic
1179773427 21:43642433-43642455 TACAGCAAAGGCTACAGATAAGG + Intronic
1181449997 22:23013444-23013466 CACAGCAAAGTCTGCAGATTTGG + Intergenic
1182339188 22:29605690-29605712 TTCAAGAAAATCTACAAATTCGG + Intronic
1182459639 22:30474631-30474653 TACAGCAAACAAGACAGATTAGG + Intergenic
1183090378 22:35518331-35518353 TTCAGCTAAGTCCACAGATAGGG + Intergenic
949823231 3:8137928-8137950 ATCAGAAAACTCTACAAATCAGG + Intergenic
950362927 3:12462470-12462492 CACAGCAAACTCCACAGATTAGG + Intergenic
951344477 3:21530365-21530387 TTGAGCAAAGTCTACATTTTAGG + Intronic
951624744 3:24646742-24646764 TCCACCAAACCCCACAGATTAGG - Intergenic
952618488 3:35305261-35305283 TCTAGCAAAATCCACAGATTTGG - Intergenic
953221134 3:40972809-40972831 TGCAGCAAACTCTACCAACTAGG + Intergenic
955655411 3:61240147-61240169 TTCAGAAAAATCTACAGCTGAGG - Intronic
955930344 3:64050003-64050025 GTGAGCAAACTCAAGAGATTAGG + Intergenic
957819429 3:85351613-85351635 TGCAGTAAACTTTACATATTTGG - Intronic
958543891 3:95515301-95515323 ATCAGCAAACACTACAAATCAGG + Intergenic
958942835 3:100334453-100334475 ATCAGCAAACGCTACAAATCAGG + Intergenic
963253907 3:143125623-143125645 TTCAGCAAACTTTACTGAACAGG - Intergenic
963517611 3:146327617-146327639 TTCAGCACACTCTAAAGAGGTGG + Intergenic
964444606 3:156745485-156745507 TTCATCAAACTCTACACCTCAGG - Intergenic
964746460 3:160017176-160017198 AACAGCAAAGTCTACATATTTGG + Intronic
964795669 3:160494109-160494131 TTAAGCAAACTCCACTGCTTTGG - Intergenic
965522007 3:169677687-169677709 TTCTAAAACCTCTACAGATTGGG + Intergenic
966302183 3:178491984-178492006 ATCAGCAAACACTACAGATTAGG + Intronic
968379141 4:73984-74006 TTCAGCAAACTCCATATATTTGG + Intronic
968395604 4:233873-233895 TTCAGCAAACTCCATATATTTGG + Intergenic
968407450 4:353048-353070 TTCAGCAAACTCCATATATTTGG + Intronic
968414422 4:418003-418025 TTCAGCAAACTCCATATATTTGG + Intergenic
971526748 4:27629345-27629367 TTCAATAAACTCTTCAGAATGGG + Intergenic
973605377 4:52581902-52581924 GGCAACAAACTCTGCAGATTGGG - Intergenic
974419460 4:61653740-61653762 TTTAGCAAAATCTCCAGATTTGG + Intronic
975415185 4:74097849-74097871 TTCAGAAAACTCTAGAGCCTGGG - Intronic
975930133 4:79511344-79511366 TTCAGTAAACAGTACTGATTGGG + Intergenic
976424707 4:84888808-84888830 ATCAGCAAACACTAAAAATTGGG + Intronic
977134186 4:93281658-93281680 CTCAGCCAACTATACAGCTTTGG - Intronic
977179966 4:93861614-93861636 TTCAGCAAACTCTACATAGAAGG + Intergenic
978137580 4:105281288-105281310 TTCCCCACACTCTACGGATTAGG - Intergenic
978674452 4:111294158-111294180 TTGAGGAAACTCTCCAGATATGG + Intergenic
978851435 4:113341777-113341799 TTTGGCAAACACTACAAATTTGG - Exonic
979559166 4:122082654-122082676 TACAGCAACCTCTTCAGACTGGG - Intergenic
980411625 4:132426953-132426975 CTCAGAATAATCTACAGATTCGG - Intergenic
980551651 4:134343903-134343925 ATCAGCAAACACTACAGATGAGG - Intergenic
982148245 4:152422320-152422342 TTTGGGAAACTCAACAGATTTGG - Intronic
984896370 4:184544825-184544847 ATCAGCAAACACTACAAATCAGG - Intergenic
985745487 5:1644516-1644538 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
985745498 5:1644581-1644603 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
985745509 5:1644646-1644668 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
985745521 5:1644711-1644733 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
985745533 5:1644776-1644798 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
985745545 5:1644841-1644863 TTCAGCAAACTCTGCAGGAGAGG - Intergenic
985745558 5:1644906-1644928 TTCAGCAAACTCTGCAGCAGAGG - Intergenic
988844964 5:35118575-35118597 TTGAGTAAGCTCTATAGATTAGG - Intronic
992082606 5:73249247-73249269 ATCAGCAAACTCTGCAGATCTGG + Intergenic
993915149 5:93735457-93735479 TTCTGCAGCCTCTACAGATGTGG - Intronic
999117810 5:149179208-149179230 TTCATAGAACTCTAAAGATTTGG + Intronic
1000982633 5:167832899-167832921 ATCAGCAAATGCTACAGATCAGG + Intronic
1001616039 5:173044490-173044512 GTCAGAAAACTCTTCAGGTTTGG + Intergenic
1001837670 5:174845520-174845542 CTCACCACACTCTACAGATGAGG + Intergenic
1001883352 5:175265018-175265040 TTCAGCAAACTCAGGAGAATGGG + Intergenic
1002127229 5:177055334-177055356 CTCAGAAAAATCTACATATTAGG - Intronic
1002716990 5:181234097-181234119 AGCAGCCAACTCCACAGATTGGG - Intronic
1003340039 6:5211810-5211832 TTCAGCAAAATCTAAGTATTTGG - Intronic
1004324371 6:14661138-14661160 TGTAGCAACTTCTACAGATTGGG + Intergenic
1006424452 6:33955655-33955677 CGCAATAAACTCTACAGATTTGG + Intergenic
1007325445 6:41055911-41055933 ATCAGCAAACTTTAGAAATTGGG + Intronic
1008066841 6:47059129-47059151 ATCAGGACACTTTACAGATTTGG + Intergenic
1008266763 6:49437263-49437285 ATCAGCAAACACTAAAAATTAGG - Intronic
1008864751 6:56196180-56196202 TTCAAAAAACTCAACAAATTAGG + Intronic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1010547719 6:77178785-77178807 TTCAGCACTCTCTCCAGCTTTGG - Intergenic
1011280644 6:85673768-85673790 TTCATCAGACACTGCAGATTGGG - Intergenic
1011479761 6:87782336-87782358 TGGCGCAAACTCTACTGATTAGG - Intergenic
1011615663 6:89195889-89195911 ATCAGCAAACACTACAAATCAGG + Intronic
1011636476 6:89379237-89379259 TTCAGCAAATTCTCCAGAGTTGG + Exonic
1012313997 6:97762428-97762450 ATGAGGAAATTCTACAGATTAGG - Intergenic
1012431292 6:99166078-99166100 GTCAGCAAAGTTTACAAATTGGG - Intergenic
1012936894 6:105377816-105377838 TTAGGCCAACTTTACAGATTGGG + Intronic
1014506603 6:122267194-122267216 TTAAGCAATCTCTATAGCTTGGG - Intergenic
1015385312 6:132616159-132616181 ATCATCAAACTCTACAAATTAGG + Intergenic
1015868060 6:137747790-137747812 TTCAGTAAAATCTAAAGACTGGG - Intergenic
1016088733 6:139948299-139948321 TTTAGAAAACTCTAAATATTTGG + Intergenic
1017434706 6:154404988-154405010 TTCAGCAAACTCAACAATTCCGG + Exonic
1017663849 6:156699644-156699666 TTCAGCCATTTCTACAGAGTTGG - Intergenic
1020255416 7:6500523-6500545 CTAAGCAAACTCTACAGCTTGGG - Intronic
1021268721 7:18558468-18558490 TCCACCATACTCTACAGATGGGG + Intronic
1021298706 7:18942792-18942814 ATCAGCAAATACTACAAATTAGG + Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023570316 7:41565159-41565181 CTTAGCAAACTCTAGAGAGTAGG - Intergenic
1025265901 7:57456761-57456783 TTTAGCAAACTCCACAGATTTGG + Intronic
1025747344 7:64255037-64255059 GTTAGCAAACTCCACAGATTTGG + Intronic
1025789070 7:64671051-64671073 TTAAGCAAACTTTACAGATTTGG + Intronic
1025815533 7:64907687-64907709 TTCCACAAACTCTAGAGATTTGG + Intronic
1025824806 7:65001751-65001773 TTCAGCAAACATTACAGTTTTGG - Intronic
1026319065 7:69253222-69253244 ATTAGCAAACACTACAAATTAGG + Intergenic
1028268869 7:88761827-88761849 TTCTGCAAGCCCTACAGATTTGG - Intronic
1030088713 7:105838843-105838865 TCCAGCCAACTCTTCAGATGAGG - Intronic
1031482447 7:122295373-122295395 TTCAGCAAAATCTACATTTTGGG - Intergenic
1037013929 8:13879218-13879240 TTCAGCAAACTCAAGAGCATTGG - Intergenic
1037046898 8:14317391-14317413 TTCAGCATACACTACAGCTCTGG - Intronic
1037086408 8:14856339-14856361 TTCATCAACCTCTAAAGGTTAGG + Intronic
1037428332 8:18782293-18782315 TTCATCCAACTCTATGGATTGGG + Intronic
1038400849 8:27283637-27283659 TCCAGCAACATCCACAGATTTGG + Intergenic
1040537264 8:48321188-48321210 ATGAGCAAACACTACAGATTAGG + Intergenic
1041007258 8:53507752-53507774 TTTAGCCAATTCGACAGATTTGG + Intergenic
1042469735 8:69172148-69172170 TTCAGCATAGACTACACATTGGG - Intergenic
1044662371 8:94604143-94604165 TTGACCAAACTCTACACATCAGG - Intergenic
1045296187 8:100873302-100873324 TTCAGGAAGCTCTACAGACTGGG + Intergenic
1046690402 8:117277787-117277809 TTCAAAAAACTCCAGAGATTTGG + Intergenic
1046856982 8:119043478-119043500 TTCAAGAAACTCTACAGTTTTGG - Intronic
1047954969 8:129967291-129967313 ATCAGCAAATGCTACAAATTAGG + Intronic
1048204666 8:132405754-132405776 TGCAGTAAACACTGCAGATTTGG + Intronic
1048811957 8:138296537-138296559 TTCAGCAAATGCTACCCATTTGG - Intronic
1050623794 9:7482001-7482023 TTCATCTAATTCTACAGATGAGG + Intergenic
1052136014 9:24910988-24911010 TTTAGGAAACTCAACACATTGGG + Intergenic
1052787162 9:32839470-32839492 TTAAGACAACTCTACAGTTTGGG - Intergenic
1056253790 9:84777641-84777663 ATCAGCAAACATTACAAATTAGG - Intronic
1056840216 9:89992664-89992686 GTCAGCAAAGGCTACAAATTAGG - Intergenic
1058759493 9:108117240-108117262 TTCAGCAAACTCTGCCAACTCGG - Intergenic
1061093760 9:128442266-128442288 CTCAGGAAACTCTGCAGTTTGGG - Intergenic
1187613446 X:20967929-20967951 ATCAGCAAACACTACAAATCTGG - Intergenic
1188935211 X:36167368-36167390 TTCAGCAAACCCTCCATTTTAGG + Intergenic
1189338633 X:40187171-40187193 ATCGGCAAACACTACAAATTGGG - Intergenic
1189527208 X:41836065-41836087 TTTAGCAAACTGTACATCTTTGG - Intronic
1190393841 X:49959888-49959910 TTCAGCAACCTCTTCATATGGGG + Intronic
1192144414 X:68671735-68671757 TTCACCAAACTCTTGAAATTTGG + Intronic
1192757503 X:74061953-74061975 TTTAGCAGGCTCTACAGCTTAGG - Intergenic
1194561025 X:95420553-95420575 TTTAACAAACTAGACAGATTAGG - Intergenic
1195333095 X:103822127-103822149 TGAAGCAAACTCTAAAGATTGGG - Intergenic
1195398261 X:104434521-104434543 TTAAAGAAACTCTAAAGATTAGG + Intergenic
1195982312 X:110592395-110592417 ATCAGCAAACACTATAGATCAGG + Intergenic
1196010046 X:110876999-110877021 ATCAGCAAACACTACAAATCAGG - Intergenic