ID: 1164007987

View in Genome Browser
Species Human (GRCh38)
Location 19:21169494-21169516
Sequence GAGGGCATTCCATCACCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 1, 2: 8, 3: 11, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164007987_1164007996 17 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007996 19:21169534-21169556 GGGGTTGTAGCTTTGTCACAAGG 0: 2
1: 12
2: 10
3: 23
4: 131
1164007987_1164007997 24 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007997 19:21169541-21169563 TAGCTTTGTCACAAGGCTGCTGG 0: 2
1: 15
2: 20
3: 50
4: 422
1164007987_1164007998 25 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007998 19:21169542-21169564 AGCTTTGTCACAAGGCTGCTGGG 0: 2
1: 16
2: 15
3: 23
4: 167
1164007987_1164007995 -2 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007995 19:21169515-21169537 TCTGGGTTTGTAGTGAAGAGGGG 0: 5
1: 8
2: 16
3: 29
4: 274
1164007987_1164007993 -4 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007993 19:21169513-21169535 CCTCTGGGTTTGTAGTGAAGAGG 0: 5
1: 8
2: 17
3: 20
4: 156
1164007987_1164007994 -3 Left 1164007987 19:21169494-21169516 CCCTAGGGTGATGGAATGCCCTC 0: 1
1: 1
2: 8
3: 11
4: 72
Right 1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG 0: 5
1: 10
2: 18
3: 32
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164007987 Original CRISPR GAGGGCATTCCATCACCCTA GGG (reversed) Intronic
902434164 1:16386592-16386614 GAGGGCATCGCATCTCCCTCTGG - Intronic
904243002 1:29162647-29162669 GAGGCCATTCCATCACGCCCAGG - Intronic
919775590 1:201192140-201192162 CATGGCATTCCAGCACGCTAGGG + Intronic
1066974204 10:42349873-42349895 TAGGGCATCCCATTACCCTGGGG + Intergenic
1069247887 10:66230723-66230745 CAGGGCTTTCCATCACCATCAGG - Intronic
1070554677 10:77518410-77518432 GAGGGCATTGCTTAACCCAAAGG - Intronic
1071707202 10:88012079-88012101 AAGGTCATTCCAGCAACCTAAGG - Intergenic
1071826900 10:89334359-89334381 GAGGGAATCCTATCTCCCTAAGG + Intronic
1074640739 10:115377729-115377751 GAGGCAATTCCATCAGCCCAAGG - Intronic
1076497381 10:130905821-130905843 AAGGGCTTTCCAGCACCCTCAGG + Intergenic
1082315229 11:50709212-50709234 GAGGGAATTCCCTGACCCTTTGG + Intergenic
1088212565 11:107472957-107472979 GAGGCATTTCCATCACCCTAAGG + Intergenic
1091652610 12:2320961-2320983 GAGGGGCTTCCATCACCACACGG + Intronic
1102775771 12:115517552-115517574 GAGGGCACTCCAGCAGCTTATGG + Intergenic
1103044182 12:117721703-117721725 GAGTGCATTCCTACTCCCTAGGG + Intronic
1105229820 13:18481654-18481676 TAGGGCATCCCATTACCCTGGGG + Intergenic
1114014068 14:18408491-18408513 TAGGGCATCCCATTACCCTGGGG + Intergenic
1123885906 15:24728222-24728244 GAGGGCAGTCCTCCATCCTACGG - Intergenic
1125490823 15:40147286-40147308 GCTGGCCTTCCATCACTCTAGGG - Intergenic
1131117479 15:89803961-89803983 CAGGTCATTCCACCACTCTATGG + Exonic
1134302919 16:13007572-13007594 GAGGGCCTCCCATGACCCTAGGG + Intronic
1150784338 17:68150714-68150736 GAGAGGGTTCTATCACCCTAGGG + Intergenic
1152362045 17:79837267-79837289 GGGGGCAACCCAGCACCCTATGG + Intronic
1153484497 18:5582967-5582989 GGGTCCCTTCCATCACCCTATGG - Intronic
1156154879 18:34289485-34289507 AAGGGCAAACCATCTCCCTAGGG + Intergenic
1157523179 18:48359293-48359315 GAAAGCTTTCCTTCACCCTAGGG - Intronic
1159447840 18:68561893-68561915 GAGGAGGTTCCATCAGCCTAGGG + Intergenic
1160127759 18:76194047-76194069 GAGGCAATTCCATCAGCCTGGGG - Intergenic
1163869155 19:19803670-19803692 GAGGGAATCTCATCACACTAAGG + Intronic
1163873566 19:19846260-19846282 GAGGGCATCTCCTCACCCTAAGG + Intergenic
1163882253 19:19935367-19935389 GAGGGCATCTCATCACCCTAAGG + Exonic
1163901636 19:20106800-20106822 GAGGGCATCTCATCACACTAAGG - Intronic
1163903515 19:20129630-20129652 GAGGGCATCTCATCACTCTAAGG + Intergenic
1163910593 19:20187852-20187874 GAGGGCATCTCATCACCCTAAGG - Intronic
1163917307 19:20252442-20252464 GAGGGCATCTCATCACCCTAAGG - Intergenic
1163925091 19:20333407-20333429 GAGGGCATCTTATCATCCTAAGG - Intergenic
1163931085 19:20392821-20392843 GAGAGCTTATCATCACCCTAAGG - Intergenic
1163932314 19:20407770-20407792 GAGGGTGTCTCATCACCCTAAGG + Intergenic
1163936752 19:20453337-20453359 GATGGCATCTCATCACCCTAAGG - Intergenic
1163941401 19:20498352-20498374 GAGGGCATCTCATCACCCTAAGG - Intergenic
1163956300 19:20644491-20644513 GAGGGCATCTCATCACCCTAAGG + Intronic
1163959911 19:20679925-20679947 GAGGGCATCTCATAACCCCAAGG - Intronic
1163974522 19:20837267-20837289 GAGGGCATCTCATCACCCTAAGG + Intronic
1163984931 19:20937382-20937404 GAGGGCATCCCGTCACCCTGGGG - Intronic
1164001223 19:21101291-21101313 GAGGGCATCCCATCACCCTAGGG - Intronic
1164007987 19:21169494-21169516 GAGGGCATTCCATCACCCTAGGG - Intronic
1164014698 19:21242974-21242996 GAGGGCATCCCAGAACCCTGGGG + Intronic
1164031267 19:21407981-21408003 GAGGGCATCCCAAAACCCTGGGG - Intronic
1164102929 19:22075061-22075083 GAGGGAATCCCATCACCCTGGGG - Intronic
1164113367 19:22191810-22191832 GAGGGCATTCTATCACCCTGGGG + Intronic
1164134439 19:22400598-22400620 TAGGACATCCCATCACCCTGGGG + Intronic
1164141169 19:22465849-22465871 GAGGGCATCCCATCACCCTGGGG - Intronic
1164164373 19:22656175-22656197 TAGGACATCCCATCACCCTGGGG - Intronic
1164279111 19:23752716-23752738 GAGGGCATCTCATTACCCTGGGG + Intronic
1164285250 19:23809992-23810014 GAGGGCATTCTATCACATTGGGG - Intronic
1164297133 19:23922028-23922050 GAGGATATTCTATCACCCTGGGG - Intronic
1164317621 19:24107822-24107844 GAGGACATTCTATCACTCTGGGG - Intronic
1164561664 19:29296596-29296618 GAGGTCATTCCACCAGCCTGTGG + Intergenic
925884025 2:8378875-8378897 GAGGGCTTTGAATAACCCTAGGG + Intergenic
932306565 2:70707836-70707858 GAGAGCATTCCATCTCCTCATGG - Intronic
935590085 2:104839102-104839124 GAGGACCTTCAATCCCCCTAGGG + Intergenic
942329739 2:174810029-174810051 GAGTTCATTCCAGCATCCTATGG + Intronic
1174039585 20:47689417-47689439 GAGGACACTCAAACACCCTATGG + Intronic
1176943081 21:14947456-14947478 TCGTGCATTCCATCACCCCATGG - Intergenic
1180438567 22:15339297-15339319 TAGGGCATCCCATTACCCTGGGG + Intergenic
1180521420 22:16209725-16209747 TAGGGCATCCCATTACCCTGGGG + Intergenic
953463864 3:43103017-43103039 GTGGCCATTCTCTCACCCTAAGG + Intronic
970408321 4:15784599-15784621 GTGGTCATTCCATCACTCCAGGG - Intronic
972961608 4:44460037-44460059 GTGGACATTCCATCAGCCTAAGG + Intergenic
980547876 4:134292882-134292904 GAGGTAATCCCATCAGCCTATGG + Intergenic
980681801 4:136172201-136172223 TAGGGCACTCCAGCAACCTAAGG + Intergenic
981188308 4:141831823-141831845 GGTGGCATTCCATTACCCAAAGG - Intergenic
990444626 5:55882668-55882690 GTGGGTATTCCATCATCCTAGGG + Intronic
990957582 5:61359171-61359193 GAGGGCATTCCATCCAGATATGG + Intronic
993482767 5:88445230-88445252 GAGGACACTCAAGCACCCTATGG - Intergenic
1001689922 5:173625418-173625440 GAGGACATTCCATGTCCCAAGGG + Intergenic
1004133487 6:12944204-12944226 GAGGGCATGCCATCTCAGTATGG + Intronic
1007466850 6:42058565-42058587 GAGGGCTTGCCATCACTATATGG - Intronic
1016317558 6:142807407-142807429 GGGGGCATTCTATCATCCAAAGG + Intronic
1025036444 7:55595449-55595471 GAGGACATTCAGTCAGCCTATGG - Intergenic
1025791639 7:64693488-64693510 GAGGGCATCCCATCACCTGGGGG - Intronic
1025804388 7:64816835-64816857 GAGGGCATCCCATCACCTGGGGG - Intronic
1025816684 7:64920085-64920107 GAGGGCAAACCATCACTCTGGGG - Intronic
1026616688 7:71911331-71911353 GAGGGTATGCCATCACCCTGGGG + Intronic
1027600766 7:80237845-80237867 GGGGGAAATCTATCACCCTATGG + Intergenic
1054411647 9:64821654-64821676 TAGGGCATCCCATTACCCTGTGG - Intergenic
1186219890 X:7338918-7338940 GAATGAATTCCATTACCCTATGG - Intronic
1190068774 X:47261972-47261994 AAGGGCATTCCATCACAGGATGG + Intergenic
1193458999 X:81767676-81767698 AAGGGAATACCATCACCTTAGGG + Intergenic
1193739645 X:85202768-85202790 GAGGCCAGTCCATCTCCCTTAGG - Intergenic
1194205676 X:91008578-91008600 GAGGGCATCACATCACCAGAGGG - Intergenic
1196152629 X:112392032-112392054 GAGGCCATTCCATCTCCCAGAGG - Intergenic
1200551435 Y:4583389-4583411 GAGGGCATCACATCACCAGAGGG - Intergenic