ID: 1164009314

View in Genome Browser
Species Human (GRCh38)
Location 19:21184998-21185020
Sequence TTGTGCAAATATAATAAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164009314 Original CRISPR TTGTGCAAATATAATAAATT TGG Exonic
900618525 1:3576419-3576441 TTGTTCAAATGAAATAATTTGGG + Intronic
901978512 1:13014672-13014694 CTGTACAATTATAATAAAATTGG + Intronic
902003571 1:13214266-13214288 CTGTACAATTATAATAAAATTGG - Intergenic
902929468 1:19720540-19720562 ATGGGCAAATATAAAACATTAGG - Intronic
907200141 1:52719390-52719412 TTATGCATATATAAGCAATTAGG + Intergenic
907781480 1:57570956-57570978 TTTTGCAGCTATTATAAATTGGG + Intronic
909400052 1:75217821-75217843 TTTTGTGAAGATAATAAATTGGG - Intronic
909585945 1:77288352-77288374 TTTTGAAAATATAATGATTTTGG - Intronic
909705805 1:78582495-78582517 TAGAGAAAATATAATAATTTTGG + Intergenic
910145553 1:84077124-84077146 TTGGGAACATAGAATAAATTGGG + Intergenic
910848385 1:91626325-91626347 TTGTGCAATTATAAGAAAAATGG + Intergenic
911366113 1:96939536-96939558 TTGTGCAGATAAAAGAAATATGG - Intergenic
911395417 1:97301378-97301400 TGGTGAAAATAGAACAAATTTGG + Intronic
911897692 1:103458508-103458530 TTGTACAAATATATTTTATTGGG - Intergenic
911966481 1:104378482-104378504 GTGTGAAAAGAAAATAAATTTGG + Intergenic
912176378 1:107162936-107162958 ATGTGTAACTGTAATAAATTTGG + Intronic
912453423 1:109782152-109782174 TGGTGCAAATATAAGGAAATGGG - Intergenic
913092546 1:115488713-115488735 AGGTGCAAATCTAACAAATTTGG + Intergenic
915860149 1:159435501-159435523 TTATCCAAATATTATCAATTTGG + Intergenic
916151467 1:161796266-161796288 AGGTGTAAATATAATGAATTAGG - Intronic
916339537 1:163714259-163714281 TTTTGCACATTTAAAAAATTAGG + Intergenic
916438569 1:164799581-164799603 TTGTGCAAATAAAGAAAACTAGG - Intronic
916998386 1:170327198-170327220 TTTTGCAAAGATAATTTATTAGG + Intergenic
917382252 1:174425241-174425263 ATGTGCAGATATTATAAATGTGG - Intronic
918862133 1:189843030-189843052 TTGAGCAAATAGAACAAAGTTGG - Intergenic
918995569 1:191754380-191754402 TTGTGCAAATATTATGAAACAGG + Intergenic
919195888 1:194285766-194285788 TTGTACAAAAATAATCATTTAGG - Intergenic
919340207 1:196296688-196296710 TTTTCCCAATATAATAAATCAGG + Intronic
921462074 1:215440998-215441020 CTATGCAAATATAATAAAAATGG - Intergenic
922143667 1:222916799-222916821 TTGTGAAAAGATAAGAAATAAGG - Intronic
922637557 1:227190248-227190270 TTGTGCAAAGAACATAAATCTGG + Intronic
924001082 1:239553255-239553277 TTTTGAAAATAAAATTAATTTGG + Intronic
924045631 1:240026380-240026402 TTTTGGAAAAATAATAAAATTGG + Intronic
924316198 1:242800044-242800066 TTGTGCAAATCAATTAATTTGGG - Intergenic
924684241 1:246271283-246271305 TTATGAAAATTTAAAAAATTTGG - Intronic
924897003 1:248349804-248349826 TGGTGTAAATTTAATAAATAAGG + Intergenic
1063018987 10:2107229-2107251 CTGTGCAAATATGAAAACTTTGG - Intergenic
1064891698 10:20182420-20182442 TAGTTCAAATATCAGAAATTTGG + Intronic
1065308368 10:24390167-24390189 ATCTACAAATATAATAAGTTAGG - Intronic
1065581326 10:27174803-27174825 TTTTGCAACTATGATTAATTAGG - Intronic
1065904753 10:30240427-30240449 TTTTTAAAAAATAATAAATTAGG - Intergenic
1066122151 10:32299888-32299910 TTTTGCAATTATCATAAATCAGG - Intronic
1066783940 10:38981044-38981066 TTGTTCAAAGATAAAAAATTTGG + Intergenic
1067759504 10:49033402-49033424 TTGGGAATATATAATAAATATGG + Intronic
1068052163 10:51963767-51963789 TTGTGCACATAAGAAAAATTAGG + Intronic
1068241536 10:54307767-54307789 TAGTGCAATCAGAATAAATTAGG + Intronic
1068701762 10:60027829-60027851 TTGTACAAATATAAGAAATGAGG + Exonic
1069326584 10:67238139-67238161 TTGTGCTGATATATTACATTTGG - Intronic
1069327093 10:67244626-67244648 ATATGCTAAAATAATAAATTTGG + Intronic
1071025680 10:81110136-81110158 ATGTGGGAATCTAATAAATTGGG - Intergenic
1071383363 10:85094650-85094672 TTGAGCAAAAATAACAAATCTGG - Intergenic
1071411085 10:85396701-85396723 TTGTGAGAATATTTTAAATTAGG - Intergenic
1071513095 10:86278907-86278929 TTGTCCTAATAGAACAAATTGGG - Intronic
1072159242 10:92750911-92750933 TTGTGCAATGAAAAAAAATTTGG - Intergenic
1072447719 10:95514067-95514089 TTGTGTAAAAAAAAAAAATTAGG - Intronic
1072776353 10:98199076-98199098 CTGTGCATATAAAATACATTTGG - Intronic
1072835608 10:98708479-98708501 TTGTCTAAAAATATTAAATTGGG - Intronic
1073738989 10:106384487-106384509 GTATGCAAATCTAATAAAATGGG + Intergenic
1074330152 10:112498895-112498917 TGGTGAAAATAGAATAATTTAGG - Intronic
1074661483 10:115663377-115663399 TTGTGCATACATAATATAATAGG + Intronic
1074777481 10:116776843-116776865 TGATGCAAATATGATAATTTAGG + Intergenic
1074892230 10:117745236-117745258 ATGTGCAAACCTAATACATTGGG - Intergenic
1075314814 10:121444259-121444281 TTTTATAAATATTATAAATTTGG - Intergenic
1075549177 10:123379512-123379534 TTGGGCAAAAGGAATAAATTAGG - Intergenic
1075767318 10:124903962-124903984 TTGTGGAAATGTAAACAATTTGG - Intergenic
1078227143 11:9402556-9402578 TAGTAAAAATATAAAAAATTAGG + Intronic
1078478344 11:11653859-11653881 TAGTGAAAATATAGTAACTTTGG + Intergenic
1079574307 11:21984393-21984415 TTGGCCTAATATAATAAATGTGG + Intergenic
1079659958 11:23024482-23024504 TATTGAAAATTTAATAAATTAGG - Intergenic
1079872596 11:25818785-25818807 TTGTGAAAATATATTCAAATTGG - Intergenic
1079879788 11:25911940-25911962 ATATGTATATATAATAAATTAGG - Intergenic
1080323080 11:31037585-31037607 TTGTAAAAATACAAAAAATTAGG - Intronic
1080478024 11:32616185-32616207 TTGAGCAAATGTGATAAATGTGG + Intronic
1081137340 11:39454521-39454543 TTTTGCAAATAAAAATAATTTGG + Intergenic
1081359972 11:42163864-42163886 ATGTACAAAGAAAATAAATTTGG + Intergenic
1081741818 11:45446269-45446291 TTGTGCAAATTTAAAAAAGATGG + Intergenic
1081816501 11:45946673-45946695 ATATGAAAAAATAATAAATTCGG - Intronic
1082915028 11:58424103-58424125 TTCTGCAGATAAAATAAATAAGG - Intergenic
1083536386 11:63470745-63470767 TTGTACAAATATAAAGAATGTGG + Intronic
1084350062 11:68590562-68590584 TAGTGTAAATATCTTAAATTTGG + Intronic
1086216508 11:84388541-84388563 TTGTGAAATTTGAATAAATTAGG - Intronic
1086516065 11:87614810-87614832 TTGTGATAATAAAATAAATTGGG - Intergenic
1087246433 11:95843678-95843700 TTTTGCAAATTTAATGAGTTTGG - Intronic
1087601423 11:100320998-100321020 TTGAGCAAAAAGAATAAAATTGG - Intronic
1088317614 11:108523177-108523199 TTGTTCAAATACAAGAAAGTTGG - Intronic
1088417334 11:109604134-109604156 TTGTACAACAATAATAATTTTGG + Intergenic
1090562975 11:127953058-127953080 CTGTGAAAAAAAAATAAATTAGG - Intergenic
1090684149 11:129096835-129096857 TTGGGAAAATATAATAGACTAGG + Intronic
1090705458 11:129332275-129332297 CTATGCAAATAAAATAAATTTGG - Intergenic
1091431299 12:437350-437372 TGGGGCAAAAATAATAAATAAGG + Intronic
1092455020 12:8635409-8635431 TTGTGCAAGAAGAATAAATTTGG + Intergenic
1092690752 12:11107595-11107617 TTGTTAAAAAATAACAAATTTGG + Intronic
1092693452 12:11142394-11142416 TTGTTAAAAAATAAGAAATTTGG + Intronic
1092978323 12:13768050-13768072 TAGTGCATATTTAATAAATAAGG - Intronic
1093206389 12:16256555-16256577 TTTTTAAAAAATAATAAATTAGG + Intronic
1093412105 12:18879333-18879355 TTGTAAAAAGAGAATAAATTTGG - Intergenic
1093505974 12:19866479-19866501 TTGTGTAATTATGATAAAGTAGG + Intergenic
1094237034 12:28179943-28179965 TTATGCTATTATTATAAATTTGG + Intronic
1094325884 12:29238329-29238351 TTTTGCAAATATCTTTAATTGGG - Intronic
1094736065 12:33235077-33235099 TTACACAAATATAATAAATATGG - Intergenic
1095200273 12:39376231-39376253 TTATGCAAAGATAATAAAGCTGG + Intronic
1095514682 12:42992773-42992795 TTGTGCTTATAAACTAAATTTGG - Intergenic
1097613819 12:61859761-61859783 TTGTTCAAAAATAAGAAGTTGGG + Intronic
1097997254 12:65901973-65901995 TTTTTCAAATATAATAAAAATGG + Intronic
1098261671 12:68677691-68677713 TACTGAAAATATAAAAAATTAGG - Intergenic
1099040352 12:77645653-77645675 GTTTGCAAATATATTAATTTTGG + Intergenic
1099193821 12:79590835-79590857 TTCTGTAACTATATTAAATTTGG + Exonic
1099265157 12:80437155-80437177 CTGTGCAACTACAATAAGTTTGG - Intronic
1099705336 12:86145389-86145411 TTGTGCAAGAAAAATAAATTGGG + Intronic
1100254370 12:92867612-92867634 ATGTGCACAAATAATAAATGAGG - Intronic
1101613431 12:106312880-106312902 TTGGGAAAAAAAAATAAATTAGG + Intronic
1101928576 12:108993638-108993660 TGCTGCAAATAAAATAAACTGGG + Intronic
1102414870 12:112752150-112752172 TTTTGAAAATATAAAAGATTGGG - Intronic
1103100737 12:118172799-118172821 ATGAGCAAATAAAAAAAATTGGG - Intronic
1104135101 12:125930447-125930469 TTGTGAAAATTAAATAACTTTGG - Intergenic
1104136591 12:125945625-125945647 TTGTGAAAATAAAATTAATTAGG + Intergenic
1105204373 13:18207928-18207950 TAGGGAAAAAATAATAAATTAGG - Intergenic
1105572594 13:21617917-21617939 ATGTGCAAACAAAATAACTTGGG + Intergenic
1105653431 13:22405882-22405904 TGGTGCAAATAGAAGAATTTTGG + Intergenic
1106225273 13:27781236-27781258 CTGTGAAAATAAAATAAATTAGG + Intergenic
1106611337 13:31284804-31284826 TTCTGTAAATACAGTAAATTAGG + Intronic
1106731957 13:32551030-32551052 TAGTGCATGTATAATAAATATGG + Intergenic
1106819582 13:33449544-33449566 TTGTGCAAAAAGAATAAACCTGG - Intergenic
1106829673 13:33566014-33566036 TTGTTCAAAAATATTAAATGAGG + Intergenic
1108087431 13:46808604-46808626 TTTTAAAAATATAAAAAATTAGG + Intergenic
1108228018 13:48309569-48309591 TTGTGCATATACAATTAAATGGG + Intronic
1109115340 13:58375401-58375423 TTGTGAAAATTGAATAAGTTGGG - Intergenic
1109292377 13:60492258-60492280 TTTTGGAAATATATTTAATTTGG + Intronic
1109338114 13:61018592-61018614 TTGTTCAAATAGACTAATTTGGG + Intergenic
1109769792 13:66955825-66955847 TTATGCAAATATAAGAACATAGG + Intronic
1109946471 13:69439809-69439831 TTGTGCTCATCTAATAATTTTGG + Intergenic
1110266939 13:73549213-73549235 TCATGCAAATATGATAAAGTAGG - Intergenic
1110319075 13:74139570-74139592 TTATATAAATATAATACATTTGG + Intergenic
1110500362 13:76220274-76220296 TTAGGCAAATATAATTAATAGGG + Intergenic
1110811486 13:79815799-79815821 TTTTCCAAAAATAATAAAATGGG - Intergenic
1111514180 13:89306237-89306259 TTATTTAAATATAATAATTTGGG - Intergenic
1111887057 13:94034844-94034866 TTGTGCAACTAAAATTCATTAGG + Intronic
1112611809 13:100962494-100962516 TTGTCCCAATATAAACAATTTGG + Intergenic
1112815234 13:103265065-103265087 TGGTACATATATAAAAAATTTGG - Intergenic
1112989967 13:105501251-105501273 TTGGGAAAATAGAACAAATTTGG - Intergenic
1113072092 13:106431896-106431918 ATCTGAAAATATAATAAAATTGG + Intergenic
1113138619 13:107121722-107121744 GTGTGGAAAAATAATAATTTAGG - Intergenic
1113154080 13:107298048-107298070 TTGGGCAAATTTAATAGATCAGG + Intronic
1113750651 13:112774409-112774431 TTCTCCAAATATAATAAACAGGG - Intronic
1114440046 14:22738936-22738958 ATGGGCAAAAATCATAAATTGGG + Intergenic
1114943391 14:27645790-27645812 TAAAGTAAATATAATAAATTAGG + Intergenic
1114959695 14:27870468-27870490 TTGTGAAAATATTTTAACTTTGG + Intergenic
1115178607 14:30595168-30595190 TTGGGGAAATATTAGAAATTCGG + Intronic
1115731865 14:36278276-36278298 TTTTACAAACATAATCAATTTGG + Intergenic
1116208521 14:41903097-41903119 TTTAGCAAAAATAATAATTTTGG - Intronic
1116286645 14:42981576-42981598 TTGTACAGAAACAATAAATTGGG + Intergenic
1116389282 14:44373480-44373502 TTCTTCATTTATAATAAATTAGG + Intergenic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1117034372 14:51712843-51712865 TTCTGCAACTAGAATAACTTAGG - Intronic
1117096595 14:52304901-52304923 TTGTGTAAATATAATAATTATGG + Intergenic
1117116731 14:52521432-52521454 TTTTGCAAATATCTTTAATTCGG + Intronic
1117393344 14:55283805-55283827 TTAGGTAAATATAATAAAATTGG + Intronic
1117792945 14:59360108-59360130 TGGTGGAAATATACTAAATAAGG + Intronic
1117895175 14:60476892-60476914 TTGTGGAAATATAATCAGTGTGG - Intronic
1117961467 14:61166885-61166907 TTGTTCAAATCTGTTAAATTTGG + Intergenic
1117986525 14:61391465-61391487 TTTAGCAAATATATTTAATTTGG - Intronic
1118355100 14:65006977-65006999 TTGTGGAAATAGAATATATCAGG + Intronic
1119243627 14:73084287-73084309 TGGTGCTAATAAAAAAAATTAGG - Intronic
1120529980 14:85620590-85620612 ATTTGGAAATATAATACATTTGG + Intronic
1121240872 14:92429086-92429108 TTGTGCAGAAATAAGAAAGTGGG - Intronic
1123962787 15:25423635-25423657 GTTTTAAAATATAATAAATTAGG - Intronic
1124951457 15:34325491-34325513 TGGTGAATATATAATGAATTTGG + Intronic
1125448735 15:39785659-39785681 TTATGCAAATATAGTCAATAGGG - Intergenic
1125466793 15:39961051-39961073 TAATGCAAAAACAATAAATTAGG - Intronic
1126002501 15:44224250-44224272 TTGTGGGAATTTAATAAATGAGG - Intergenic
1126353883 15:47774658-47774680 TTAAACAAATAGAATAAATTAGG + Intergenic
1126949592 15:53866529-53866551 TTGTGAAAATATTAGCAATTTGG + Intergenic
1127391818 15:58511815-58511837 TTGTTCAAATATTATAATTCTGG + Intronic
1127481190 15:59378909-59378931 TTCTCCAAATCTAAAAAATTTGG + Intronic
1127750859 15:62041473-62041495 TTATTCAAATATAGAAAATTTGG - Intronic
1128760489 15:70213298-70213320 TTGAGCAAATATAAGATAGTGGG - Intergenic
1128892653 15:71344642-71344664 TTTAGGAAAAATAATAAATTGGG + Intronic
1129551738 15:76458548-76458570 ATGTACAAATATTATATATTGGG - Intronic
1130837556 15:87665554-87665576 TTGTGAAAATGTAAACAATTTGG + Intergenic
1130972470 15:88743995-88744017 TTGTAGGCATATAATAAATTTGG + Intergenic
1131677343 15:94684099-94684121 TTGTGTAAATAAAATAATATGGG - Intergenic
1131749378 15:95490171-95490193 TTATGAAAATATAATATGTTTGG + Intergenic
1131891773 15:96979776-96979798 TTATTCCAATATAATAAATTAGG + Intergenic
1133429113 16:5720836-5720858 TTGTAGAAATATTTTAAATTGGG + Intergenic
1136669317 16:31841693-31841715 TTGGGCAAAAAGAATAAAGTTGG + Intergenic
1137062657 16:35805913-35805935 TTGTAAAAATCTTATAAATTAGG - Intergenic
1137415689 16:48276611-48276633 TTGTCCAAATACAATAAAGCAGG + Intronic
1140589884 16:76338845-76338867 TTGTGAAAATCAAACAAATTAGG + Intronic
1140607063 16:76551853-76551875 TTTTGAAAATATAATAATATGGG - Intronic
1140721683 16:77777764-77777786 TTGTCAAAATTTTATAAATTTGG + Intergenic
1141513536 16:84527848-84527870 TTATGCAAATATTATATATGAGG + Intronic
1144434588 17:15229124-15229146 TTGTGCAACTATTTTGAATTGGG - Intergenic
1147973556 17:44234388-44234410 GTGTTCACATATAATAAATCTGG + Intergenic
1149073014 17:52565737-52565759 TTTTAAAAATTTAATAAATTTGG + Intergenic
1150182266 17:63135964-63135986 ATATGCAAAAATAATAAAATAGG + Intronic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1153128759 18:1829768-1829790 TTGTGCAATTATAATGTACTTGG + Intergenic
1153469049 18:5422521-5422543 CTGTGCAAATAAAAAGAATTAGG - Intronic
1153513616 18:5882620-5882642 TTGAGAAGATATAAAAAATTGGG + Exonic
1153743715 18:8155586-8155608 TTGTTTAAATATAATAGAATGGG - Intronic
1155279336 18:24222403-24222425 TTTACCAAATATAATAAGTTGGG + Intronic
1155729654 18:29138062-29138084 ATTAGCAAATATAATAAATCTGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1155906132 18:31453967-31453989 ATTTGCTAATATAATAATTTTGG - Intronic
1156135900 18:34037063-34037085 TTCTGCAATTCTACTAAATTTGG - Intronic
1156199701 18:34816329-34816351 GTATGCAAATATGAGAAATTCGG - Intronic
1156550503 18:38011505-38011527 TGGTGCATATATTATAAAATGGG + Intergenic
1156877050 18:42027325-42027347 ATATGCAAAAATAATAAAATTGG - Intronic
1156949397 18:42875624-42875646 TTTTGCAAATAGAATATAATTGG + Intronic
1158182983 18:54738836-54738858 TTGTACAATTAAAATAAATGAGG - Intronic
1158419145 18:57277620-57277642 TTGTGCAAATAAAACCACTTAGG - Intergenic
1160238715 18:77106839-77106861 TTGTCCAATTTAAATAAATTGGG - Intronic
1162607619 19:11722902-11722924 TCGTGCAAATGAAATAAACTGGG + Exonic
1163087779 19:14994649-14994671 TTGTGAAAGTAAAATAAATTTGG + Intronic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163872807 19:19837348-19837370 TTGTACAAATATAAAGAATATGG + Intergenic
1163878171 19:19893618-19893640 TTGTGCAAATACAAAGAATATGG + Exonic
1163911569 19:20199113-20199135 TTGTACAAATATAAAGAATATGG + Exonic
1163951187 19:20588614-20588636 ATGTGCAAAAATAAAACATTGGG - Intronic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163954446 19:20623198-20623220 TTGTACAAATATAAAGAATATGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1163965428 19:20742432-20742454 ATGTGCAAAAATAAAACATTGGG + Intronic
1163972697 19:20814326-20814348 TTGTACAAATATAAGGAATATGG + Intronic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164029393 19:21387900-21387922 TCTTGCAGATATAATAAATGTGG + Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164092373 19:21969602-21969624 CCCTGCAAATTTAATAAATTTGG - Intronic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164154531 19:22582865-22582887 TTGAGGAAATTAAATAAATTAGG + Intergenic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287596 19:23833933-23833955 CCCTGCAAATATAATAAATTTGG + Intergenic
1165915391 19:39255609-39255631 TTATGCAAATATATAAAATATGG + Intergenic
1166923024 19:46244578-46244600 TTATGAAATTATAATAATTTAGG + Intergenic
1167284964 19:48593892-48593914 TGGTCCAAATATAAAAACTTTGG - Intronic
925553516 2:5102830-5102852 TTGTGCACTAATTATAAATTAGG - Intergenic
926386594 2:12341418-12341440 TTTCTCAAATATAATAAACTAGG + Intergenic
927557556 2:24046653-24046675 TAGTGGAAATACAATAAACTTGG - Intronic
927769329 2:25845005-25845027 ATGTTCAAATATAATAGACTTGG - Intronic
927815205 2:26209801-26209823 CTGTGCAAGAAGAATAAATTTGG - Exonic
928064477 2:28149396-28149418 TTGTGCAAATATACAAAGATAGG - Intronic
929819495 2:45261888-45261910 TTGTGACAATATAATTAAGTGGG - Intergenic
930472298 2:51833445-51833467 TTGAGGAAATATTACAAATTTGG - Intergenic
931158898 2:59666451-59666473 TTGTGCAATATAAATAAATTTGG + Intergenic
931419031 2:62108819-62108841 TTGTGCAAATAAAATAAAATTGG + Intronic
931467500 2:62504408-62504430 TTGGGAAAGAATAATAAATTGGG + Intronic
931681771 2:64755672-64755694 TCATGAAAACATAATAAATTAGG + Intergenic
933015822 2:77125755-77125777 TTTTTCAAATTCAATAAATTAGG - Intronic
933076623 2:77936035-77936057 TTGTGTAAAAATAAAAAAATTGG - Intergenic
933391500 2:81674705-81674727 GTGTACTAATATAATTAATTAGG - Intergenic
933635432 2:84703241-84703263 TTGTGAACATATTACAAATTGGG - Intronic
935193525 2:100796996-100797018 TTGTGCAAACAGAATAATTTAGG + Intergenic
936634775 2:114243547-114243569 GTGTGCAAATCAAATAAATGAGG - Intergenic
937715376 2:125026069-125026091 TGTTGCCAATAAAATAAATTGGG + Intergenic
937803657 2:126111358-126111380 ATTGGCAAATACAATAAATTAGG - Intergenic
938170892 2:129075819-129075841 TTGTGTAAAAAAAAAAAATTGGG + Intergenic
938693834 2:133816553-133816575 TTGAGCAAAAAGAACAAATTTGG + Intergenic
938785193 2:134621926-134621948 TTGTGCAGATATACCACATTGGG - Intronic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
939236993 2:139507538-139507560 TTCTGCAAAGAAAATAATTTTGG - Intergenic
939491673 2:142884191-142884213 TTGTTCTAAGATAATAAATATGG + Intronic
939717541 2:145603404-145603426 TTGTTCAAATCTCTTAAATTTGG - Intergenic
939746494 2:145977363-145977385 TTGTGCAAATAAATGGAATTGGG - Intergenic
939868201 2:147498563-147498585 TTATGCAAACATAAAAAATGAGG + Intergenic
940061240 2:149572062-149572084 ATGTGCATATATAAAAATTTTGG + Intronic
940127496 2:150343387-150343409 TGGTCCAAATTTAATAGATTTGG - Intergenic
940181746 2:150941978-150942000 AACTGCAACTATAATAAATTTGG - Intergenic
940256197 2:151732505-151732527 TTGGGTAAATATAATGAAGTTGG + Intronic
940368136 2:152871566-152871588 ATTTGCCAAGATAATAAATTTGG + Intergenic
942128298 2:172849594-172849616 GTGTACAAAGATAGTAAATTAGG - Intronic
942933053 2:181519554-181519576 ATATGCAAATAAAATAATTTTGG - Intronic
943057813 2:183005264-183005286 TAGGGCAACTAAAATAAATTGGG - Intronic
943486865 2:188495993-188496015 TTGTGCAAATCTATTCAATTTGG - Intronic
944593639 2:201241687-201241709 TTGGCCACATAAAATAAATTTGG - Intronic
944660853 2:201920420-201920442 TTGTTTAAATATAAAAAATGAGG + Intergenic
945343652 2:208687048-208687070 TTTTCCAAATAAAATAAATTAGG + Intronic
945564290 2:211377382-211377404 TTGTGCAAATATACAAATATAGG - Exonic
945813005 2:214570772-214570794 TTGTGAAAATGTGATAAAATTGG - Intronic
946646354 2:221839602-221839624 TTGTGCAGCTATAAAAAATGAGG - Intergenic
946917918 2:224545052-224545074 TTGTACAACTAATATAAATTTGG + Intronic
947045643 2:225980225-225980247 CTGAGCAAATACAATAATTTAGG + Intergenic
947935471 2:233999973-233999995 TTGTGAAAATATATCAATTTTGG - Intronic
949076607 2:242063124-242063146 TTGTGAACAGAAAATAAATTCGG - Intergenic
1168734570 20:119721-119743 TTCTGAAAATAGAATCAATTGGG - Intergenic
1169181327 20:3570488-3570510 TTGTCCAAAGATGACAAATTAGG + Intronic
1169886779 20:10408449-10408471 CTGTGGCATTATAATAAATTTGG - Intronic
1171727389 20:28637594-28637616 TTCTGCAAATAAAATAAAATTGG - Intergenic
1172331550 20:34079231-34079253 TTGTACCAATATAATAGATGTGG + Intronic
1172333593 20:34094886-34094908 TGGTAAAAATATAATAAAATAGG + Intronic
1173359649 20:42330942-42330964 ATGTGCAAATGAAATAAGTTGGG - Intronic
1173548909 20:43918700-43918722 TTGTATAAATATAATACAATTGG + Intronic
1174946019 20:54986324-54986346 TTGTGCAAAATTAATAGATGAGG + Intergenic
1174975865 20:55333015-55333037 TAGTGGAAAAATTATAAATTGGG + Intergenic
1175326976 20:58136681-58136703 TTGTGCTGAAATAATATATTTGG + Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1177189916 21:17839478-17839500 GTGTGCAAATATATTAATTTAGG + Intergenic
1177319162 21:19497790-19497812 TTGTGTGAATATAGCAAATTTGG + Intergenic
1177561923 21:22766945-22766967 ATGTGGTAATAGAATAAATTTGG - Intergenic
1178000853 21:28160811-28160833 ATGTGAAAATAGGATAAATTAGG + Intergenic
1178449150 21:32677342-32677364 TTGTTCCAATATGATATATTAGG - Intronic
1178785504 21:35649613-35649635 TTGTGCAAAAACACTAAATTTGG + Intronic
1178868119 21:36347297-36347319 TTCTGCAAATATGCTATATTTGG - Intronic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
1180604949 22:17051014-17051036 ATGTGCAAATAAATTAATTTGGG + Intergenic
1182266131 22:29116993-29117015 TGGTTCAAATATAACAAATGTGG - Intronic
1184898615 22:47428256-47428278 TTGATAAAATATAATAAAATCGG + Intergenic
949416493 3:3820486-3820508 TTATTCAAATACAATAAATAAGG + Intronic
949434941 3:4019037-4019059 TTTTGCACATAAAATGAATTTGG - Intronic
949504483 3:4714250-4714272 TTGAGTCAATATAATAAATGAGG + Intronic
949902511 3:8829093-8829115 TTGTGTAAATATAACATAATTGG - Intronic
950027641 3:9831653-9831675 TTTTGCAACTCTAATAAAATAGG - Intronic
950037718 3:9899161-9899183 TAGTACAAATAAAATAAACTGGG + Intergenic
952226017 3:31376837-31376859 TTTTGAAAATATAATTATTTTGG - Intergenic
952462290 3:33540603-33540625 TTCTACATATATGATAAATTTGG - Intronic
953195019 3:40724121-40724143 TTGTTCACAAATAATAAAATAGG + Intergenic
955518694 3:59753178-59753200 TTGTGTCATTATCATAAATTTGG - Intronic
955821133 3:62896557-62896579 TTATGCCAATAAAATTAATTTGG + Intergenic
957263294 3:77928629-77928651 TTGAGCAAATATTATGTATTTGG + Intergenic
957380540 3:79422960-79422982 TAGTGGAAATATACTAAATAAGG - Intronic
957526202 3:81381082-81381104 TTTTGCAAATATTTTTAATTGGG - Intergenic
957944392 3:87044061-87044083 TTGTGCAAATATAAGAAGTCTGG + Intergenic
958508999 3:95021389-95021411 TTGTTCAAATATTATTCATTAGG + Intergenic
958645523 3:96867269-96867291 TTGTGCAAATATTAACAATTTGG + Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959293130 3:104500040-104500062 TTCTTAAAATATAACAAATTCGG - Intergenic
959308586 3:104700870-104700892 TTGTGAAAGGAAAATAAATTTGG + Intergenic
959463887 3:106661256-106661278 TTGGGCAAAGATAATAAAAGAGG - Intergenic
959508550 3:107182346-107182368 TTGGGCAAGTAAATTAAATTCGG - Intergenic
959636542 3:108579183-108579205 TTCTTAAAATATAATAAACTTGG - Intronic
959737928 3:109682027-109682049 CTGTGCAAAGAAAATAAACTAGG - Intergenic
959938650 3:112057425-112057447 ATGGGGGAATATAATAAATTGGG + Intronic
961259692 3:125591699-125591721 TGCTGCTAATATATTAAATTTGG + Intronic
962046315 3:131763357-131763379 TTGTGTACTTATAATAACTTAGG + Intronic
962150934 3:132892818-132892840 ATGTGGGAATATAATGAATTTGG + Intergenic
963654580 3:148029546-148029568 ATATGCAAATATAGTAACTTTGG + Intergenic
963791856 3:149591061-149591083 TTGTGACAATAAAACAAATTAGG + Intronic
964161409 3:153650095-153650117 TTGTGTTGATATAATAGATTAGG - Intergenic
965280585 3:166747312-166747334 ATGTGCGAATATAATAAGATGGG - Intergenic
965316257 3:167194559-167194581 CTGAGCAAATATAAAAAATATGG + Intergenic
965330030 3:167361155-167361177 TTGGGCAAATAAAATAATATGGG - Intronic
967902334 3:194468001-194468023 CTGTGCAAATATCAGGAATTGGG - Intronic
967950934 3:194839977-194839999 TTGTGTAGATGTCATAAATTGGG - Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968532764 4:1103247-1103269 TTGTGCAAAGATTTTAAACTAGG - Intronic
970082980 4:12309791-12309813 TTTTGAAAATATAACAAAGTGGG - Intergenic
970949135 4:21731959-21731981 TGGAGCATATATAATAAATAAGG - Intronic
971861018 4:32105782-32105804 ATTTGTAAAAATAATAAATTTGG - Intergenic
971881419 4:32379504-32379526 TTGTGCACATAAAATAAATTTGG + Intergenic
971907758 4:32749162-32749184 TTGTGCCAATATAATCAAAATGG + Intergenic
973275012 4:48297999-48298021 TTAAGCAAATATATTAAGTTAGG - Intergenic
974381917 4:61151988-61152010 ATGTGCAAATATTTTACATTTGG + Intergenic
974389982 4:61253648-61253670 TTGTGCACATATTACAAAATAGG - Intronic
974622406 4:64376483-64376505 TTGTGCATATATTTTAATTTTGG + Intronic
974700947 4:65445738-65445760 TTGTACAAAAATATTAATTTTGG + Intronic
974985015 4:69012586-69012608 TTTTTCATTTATAATAAATTTGG - Intronic
975320140 4:73000759-73000781 TTGTGTAAATATAATTATGTAGG - Intergenic
975331700 4:73123083-73123105 TTGTTAAAATATAACAGATTAGG - Intronic
975594951 4:76041317-76041339 TTATACAAATATAAAAAATAGGG - Intronic
976269890 4:83220171-83220193 TTGTGTTAATATAATACATCTGG + Intergenic
976526429 4:86096750-86096772 TTGTTCAAATAAACTATATTAGG + Intronic
977111931 4:92967377-92967399 TTTTGAAACTAAAATAAATTGGG + Intronic
977144476 4:93420356-93420378 TTGTACAAATACACTAAAGTTGG - Intronic
977646659 4:99420478-99420500 TTGTGCATGTCTAATAACTTGGG + Intronic
977766454 4:100804443-100804465 TTGTGGTAATATACTAAAATAGG + Intronic
978358784 4:107906346-107906368 TCGTGCAAATATTATAATTGGGG + Intronic
978752672 4:112269771-112269793 ATATGTAAATATAATACATTAGG + Exonic
979056589 4:116002704-116002726 TTGTGCAAATATAATCAAATTGG - Intergenic
979162766 4:117484770-117484792 TTGTACAAATAAAATAAAATAGG + Intergenic
979303305 4:119112120-119112142 TTGTGATAATATCATAAACTAGG - Intergenic
979404610 4:120294254-120294276 TTGATCAAAAATGATAAATTAGG - Intergenic
979615889 4:122741999-122742021 TTCTTCATCTATAATAAATTTGG - Exonic
980511708 4:133799277-133799299 TTCTGCAAATTTACTAAGTTGGG - Intergenic
980543343 4:134224364-134224386 TTGATCATATTTAATAAATTAGG - Intergenic
981180706 4:141740632-141740654 TTGTGCAAAAAGAACAAAGTTGG + Intergenic
981711828 4:147716463-147716485 TTGTTCAAATCTAAAAAACTTGG - Intergenic
981825516 4:148936145-148936167 TAGTGCAAATATTAAAAATCAGG + Intergenic
981945436 4:150337730-150337752 TTGTAGCAATATAGTAAATTAGG - Intronic
981963500 4:150572464-150572486 TTCTGCAAAGATAATTAAGTTGG - Intronic
982616443 4:157642722-157642744 TTGTGAAAATATATCAGATTTGG + Intergenic
982993052 4:162303790-162303812 TTATACAAATATATTTAATTGGG + Intergenic
983007328 4:162500128-162500150 AAGAGTAAATATAATAAATTTGG + Intergenic
983492200 4:168400685-168400707 TTTTGCAAATAGAGTAAATTTGG - Intronic
983642265 4:169954045-169954067 TTTTGCAAGTAAAATAAACTTGG + Intergenic
983717418 4:170801317-170801339 TTGTGAAGAAATCATAAATTAGG + Intergenic
984178369 4:176449171-176449193 TTGGGCAAATATATGCAATTAGG - Intergenic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
984957650 4:185061334-185061356 TTTTGCTCATATAAAAAATTTGG - Intergenic
985433216 4:189901453-189901475 TTCTGCAAATAAAATAAAATTGG + Intergenic
985946271 5:3186456-3186478 TTAAGCATACATAATAAATTGGG + Intergenic
986153853 5:5154114-5154136 TTGAGCCAGTATAATAAAATAGG + Intronic
986611031 5:9567305-9567327 TTGTATAAATATACAAAATTAGG - Intergenic
986957923 5:13177806-13177828 TTGTTCAACTATTAAAAATTAGG + Intergenic
987246017 5:16049671-16049693 TTGAGAAAATTTGATAAATTTGG + Intergenic
987772680 5:22326991-22327013 TAGAGAAAAAATAATAAATTTGG + Intronic
987781260 5:22438736-22438758 TAATGTAAAAATAATAAATTAGG + Intronic
987963243 5:24837855-24837877 TGGTGCAAATATAATCATTCAGG - Intergenic
989005284 5:36804030-36804052 TTTTTGAAATAGAATAAATTGGG + Intergenic
989037531 5:37191368-37191390 TTTTACAAATAAAAAAAATTAGG + Intronic
989430424 5:41348523-41348545 TTGTGCAAATATAATAATAAAGG + Intronic
989726536 5:44593914-44593936 TTATGCAAAAATAGTAAATTTGG + Intergenic
990290411 5:54345049-54345071 TTGTGAAAATAAATTAAATTTGG - Intergenic
990929621 5:61074286-61074308 TACTGAAAATATAAAAAATTAGG + Intronic
991200171 5:63982656-63982678 TTGTGCAAGTTGAATATATTAGG - Intergenic
991393636 5:66178615-66178637 TTTTGCAAATTTAAAAAACTGGG - Intronic
992283094 5:75202602-75202624 TTAAGCAAATATAATAGCTTTGG - Intronic
992422708 5:76622523-76622545 TTTTCCAAAAATAACAAATTTGG - Intronic
992474060 5:77085364-77085386 TTGTGCACATAAAAAATATTTGG + Intronic
992603517 5:78430750-78430772 TAATGTAAATATAATAAAGTAGG - Intronic
993257434 5:85610433-85610455 TTCTGCTATTAAAATAAATTAGG - Intergenic
993374865 5:87138779-87138801 CTTTGCAAATAAAATACATTTGG - Intergenic
994134325 5:96267711-96267733 ATGTGCAAAAATAAAACATTTGG + Intergenic
994953811 5:106500525-106500547 TTGTGGAAATATTATAATCTGGG + Intergenic
994979114 5:106849989-106850011 TTGGTCAAATACAATAAAATTGG - Intergenic
996201658 5:120683335-120683357 TTGTAAAAATACAAAAAATTAGG + Intronic
996543728 5:124655868-124655890 TTCTTCAAATATAATTATTTGGG + Intronic
997176967 5:131788844-131788866 AAGTGCAAATATTATAATTTTGG - Intronic
997252984 5:132405099-132405121 TTGTGGAAATATAATATAAAGGG + Intergenic
997315651 5:132933069-132933091 TTGTGCAATAAAAAAAAATTTGG - Intronic
997562344 5:134858656-134858678 ATTTGCTAATATAATAAATAAGG - Exonic
1000112125 5:158118789-158118811 TTTTGCTAAAATAAAAAATTTGG + Intergenic
1000191213 5:158912696-158912718 CTTTGCAGATATAATAAATGGGG + Intronic
1000752962 5:165119578-165119600 CAGTGCAAATAAAATAAACTAGG - Intergenic
1002496652 5:179618448-179618470 CTATGCAAATATAAGAAATCTGG - Intronic
1002565661 5:180111847-180111869 TTATGCAAATATATTTAAATAGG + Intronic
1002951983 6:1822977-1822999 TGGTGAAAATACTATAAATTTGG + Intronic
1003849728 6:10209352-10209374 TAATGCAAATATAAATAATTAGG - Intronic
1004285704 6:14318614-14318636 TTCTGCAAATAGAATTATTTTGG + Intergenic
1005140379 6:22625081-22625103 TTTTGCAAATTTCCTAAATTTGG - Intergenic
1005232875 6:23724532-23724554 ATATGCAAATATAGTAGATTTGG - Intergenic
1006564956 6:34947885-34947907 TTTGGCAAATATAGCAAATTTGG + Intronic
1007592891 6:43033994-43034016 TTGTGCAACTATTACAATTTTGG + Intronic
1008216558 6:48797259-48797281 TTTTGCAATTATAAACAATTCGG + Intergenic
1008386169 6:50893332-50893354 TTCTGGAAATATTATAAATCTGG + Intergenic
1009602239 6:65816680-65816702 TTGTGCAAACATCATAGATTGGG - Intergenic
1009618661 6:66043886-66043908 TTATGTAAATATCCTAAATTTGG + Intergenic
1010041185 6:71386442-71386464 TTGTGCAAATGTAATCATGTGGG - Intergenic
1010179879 6:73073862-73073884 ATATGCATATATATTAAATTGGG - Intronic
1010527330 6:76918631-76918653 TTGTGGAAATATAGAACATTAGG - Intergenic
1010915301 6:81609571-81609593 ATGTTCATCTATAATAAATTGGG - Intronic
1011125681 6:84004926-84004948 TTTTAAAAATATAATATATTTGG + Intergenic
1011453862 6:87526212-87526234 TTGAGCAAAAAGAATAAAGTTGG + Intronic
1011567632 6:88694643-88694665 TTGAGCAAAAAGAATAAAGTGGG + Intronic
1012008340 6:93745677-93745699 TAGAACAAATAAAATAAATTGGG - Intergenic
1012048665 6:94311056-94311078 TTGTGGAAATACACTAAAATAGG + Intergenic
1012213144 6:96549279-96549301 TTATGCAAATAAAATTAATTTGG - Intronic
1013278627 6:108612256-108612278 ATGTAAAAATATAATTAATTGGG + Intronic
1013586977 6:111588105-111588127 TTGTGCAAAAATAAAAACTTTGG - Intronic
1014001094 6:116367319-116367341 TTTTACAAATAGAATAATTTTGG + Intronic
1014367912 6:120567585-120567607 TTATGCAAATATAATCATTTTGG + Intergenic
1015069724 6:129076981-129077003 TTATACTAATATAATAAGTTAGG + Intronic
1015352012 6:132231152-132231174 TTTTTCAAATATATTAACTTTGG - Intergenic
1015532077 6:134230711-134230733 CTCTACAAATAAAATAAATTAGG + Intronic
1015574970 6:134661499-134661521 TTGTGCAAATTTGATAAACTTGG - Intergenic
1015867906 6:137746004-137746026 ATGTGCTCATATAATAAATGGGG + Intergenic
1016372269 6:143387459-143387481 GTGTGCAAATATCATATATGAGG - Intergenic
1017223856 6:151997155-151997177 TTGTGCAAATCTAGTTAATGGGG + Intronic
1018052671 6:160024839-160024861 TTGTGCAAATAGAACATTTTTGG - Intronic
1019073080 6:169365950-169365972 TTGAGGAAATATAACAAATGGGG + Intergenic
1020364390 7:7365007-7365029 TTTTTCAAATAAAAAAAATTAGG + Intronic
1020813918 7:12880718-12880740 TTCTGCAAATATAATAGATGGGG - Intergenic
1021107081 7:16649489-16649511 TTGTGCACATGTTACAAATTTGG + Intronic
1021523474 7:21560274-21560296 TTTTACATATATAATATATTAGG + Intronic
1021532742 7:21667091-21667113 TTAAGCAAATATAAAAAATGTGG + Intronic
1022191781 7:28023356-28023378 TTTTTCAAATATCATAAATGAGG + Intronic
1022297947 7:29074235-29074257 TTGTGCAATAATAATTATTTAGG + Intronic
1022351192 7:29566826-29566848 TTGTGTAAATATTCTGAATTTGG - Exonic
1022576158 7:31498877-31498899 ATTTTCAGATATAATAAATTTGG - Intergenic
1022759776 7:33335356-33335378 TTAATCAAAAATAATAAATTGGG - Intronic
1025743049 7:64216435-64216457 TTGAGCAAAAATATTAAATTAGG + Intronic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025833385 7:65074571-65074593 TTGTGGAAACATAGTAATTTGGG - Intergenic
1025903148 7:65764080-65764102 TTGTGGAAACATAGTAATTTGGG - Intergenic
1027729097 7:81846854-81846876 TTGTGCAAATGTAATAACGCAGG - Intergenic
1027982653 7:85246111-85246133 TTATGCAAATATATTCATTTAGG + Intergenic
1028064512 7:86365842-86365864 TTGGGCAAATTTGATAATTTAGG - Intergenic
1028088027 7:86660911-86660933 TTGAGCACACATATTAAATTTGG + Intronic
1028590957 7:92494020-92494042 ATGTGAAAATATAATACATTAGG + Intronic
1030121646 7:106115718-106115740 TTGTACAATTTAAATAAATTTGG - Intergenic
1030755065 7:113277442-113277464 TTGTGCATTTAAAATAAATGAGG - Intergenic
1030943411 7:115683740-115683762 TTGTTCAAGTATAATATATATGG + Intergenic
1033388886 7:140907234-140907256 TTTTGCAAATCTATTAAGTTGGG + Intronic
1034104034 7:148475475-148475497 TACTGAAAATATAAAAAATTAGG + Intergenic
1035146101 7:156819278-156819300 ATGTGCAAATATATTTAGTTTGG - Intronic
1035738353 8:1906077-1906099 ATGTTTAAATATAATAAAGTTGG + Intronic
1036401985 8:8417142-8417164 TTGTTCAAATATGATAAACTGGG - Intergenic
1036494517 8:9257964-9257986 TTGTACAATTATAATAAAATGGG - Intergenic
1037080764 8:14783098-14783120 AATTGCAAATAAAATAAATTAGG + Intronic
1037098560 8:15015520-15015542 TACTGAAAATATAAAAAATTAGG + Intronic
1037730648 8:21520728-21520750 TTGTCCAAAACTGATAAATTAGG + Intergenic
1038113429 8:24525481-24525503 TTGTGCAAAGATAATGAGGTAGG + Intronic
1038618171 8:29115287-29115309 TTTTGCAAATATAAAGATTTGGG - Intronic
1039257134 8:35731977-35731999 TAGTGCAAGTATAATATTTTTGG + Intronic
1040814203 8:51490244-51490266 ATGTGTAAATATTATAAATCTGG - Intronic
1040918449 8:52587996-52588018 TTGAGCAAGTAGAATAATTTTGG + Intergenic
1041140861 8:54817906-54817928 TTGTGAAAATAAAATGAAATAGG - Intergenic
1041273855 8:56137114-56137136 TAAAGCAAATATAATAAACTTGG - Intergenic
1041421757 8:57674595-57674617 TTGTTCTAATAAAATAACTTGGG - Intergenic
1041428228 8:57747888-57747910 TTGTGGAAATGTTATAAACTTGG + Intergenic
1041455951 8:58060321-58060343 TTGTTCAGATATGAAAAATTTGG + Intronic
1041548979 8:59079254-59079276 TTATGCAAATATAGCAAAATTGG + Intronic
1041782621 8:61594285-61594307 TTAAGCAAAATTAATAAATTCGG - Intronic
1042125311 8:65532392-65532414 TTGTAGAAAAAAAATAAATTGGG - Intergenic
1042455784 8:69000719-69000741 TTGTAAAAATAGAATAATTTTGG + Intergenic
1042734006 8:71967533-71967555 TTGTACAAATTCAATCAATTTGG - Intronic
1043094910 8:75955503-75955525 TTGTCCAAATATAATAATATAGG - Intergenic
1043460470 8:80455116-80455138 TTATGAAAATAAAATTAATTAGG - Intergenic
1043567007 8:81559584-81559606 TTCTGCAACTATAATAAATCTGG + Intergenic
1043793299 8:84501873-84501895 TTATTCATAAATAATAAATTGGG + Intronic
1043807134 8:84685487-84685509 ATGTGCAAATGTCCTAAATTGGG - Intronic
1044249764 8:89992325-89992347 TTTTGCAAATAAACTAGATTTGG - Intronic
1044439878 8:92210358-92210380 TTTTGAAAACATAATAAATAGGG - Intergenic
1044591835 8:93920262-93920284 TTGAGAAAAAGTAATAAATTGGG - Intronic
1045824680 8:106382951-106382973 TTGTGCATCTATAGTAACTTTGG + Intronic
1046445790 8:114316602-114316624 TTATGCATATATAAAAAACTAGG - Intergenic
1047197021 8:122730886-122730908 TTGTGGAAATGTAATCTATTTGG - Intergenic
1047811890 8:128419628-128419650 TTCTGCAAATATAGGAAATTTGG + Intergenic
1048309537 8:133309198-133309220 TTGTGAAAAATAAATAAATTAGG + Intergenic
1048471208 8:134705837-134705859 TTGGGCTATTTTAATAAATTGGG - Intronic
1050040937 9:1492723-1492745 TTCAGCAAATCTAATCAATTAGG + Intergenic
1050119282 9:2291798-2291820 TTGTGCAAATATCCCAAATAAGG + Intergenic
1050450045 9:5770456-5770478 TTGTTCACATAAAATAAATATGG - Intronic
1050767984 9:9159759-9159781 TTGAGCAAAAAGAATAAAATAGG + Intronic
1051352364 9:16209486-16209508 TTATGAAAATATATAAAATTAGG - Intronic
1051711670 9:19936694-19936716 TAATGCAAATATAAAACATTTGG + Intergenic
1051903998 9:22074356-22074378 TCCTGCAGATAAAATAAATTGGG - Intergenic
1051979723 9:22999266-22999288 TTGTACAAATTGAATAAATTGGG - Intergenic
1052212196 9:25918428-25918450 ATGTGTAAATAAAACAAATTTGG + Intergenic
1052395515 9:27933541-27933563 ATGTGAAAATATAAGGAATTTGG + Intergenic
1052571365 9:30228345-30228367 TTATGAAAATATATTAAAATAGG + Intergenic
1052668705 9:31527765-31527787 GTGTGAAAATATAATATAGTGGG + Intergenic
1053174328 9:35911106-35911128 ATGTGCAAAAGTAATCAATTAGG - Intergenic
1053722352 9:40959509-40959531 TTCTGCAAATAAAATAAAATTGG + Intergenic
1054343617 9:63892489-63892511 TTCTGCAAATAAAATAAAATTGG - Intergenic
1055186811 9:73466750-73466772 TTTTGCAACTATTATAAAGTGGG + Intergenic
1055465131 9:76558014-76558036 ATGTGCAAATGGAATAGATTGGG - Intergenic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057165255 9:92920559-92920581 ATGTGCAAATGTTACAAATTGGG - Intergenic
1057289434 9:93792847-93792869 TTGAGGAAATAAAATAAAATAGG - Intergenic
1057840176 9:98479924-98479946 TTGTTCTAATATAATATGTTAGG + Intronic
1058037597 9:100270278-100270300 TTTTGGAAACATAAAAAATTGGG - Intronic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058393906 9:104527239-104527261 CTGTGAAAATATTATACATTGGG - Intergenic
1061240332 9:129367134-129367156 TTTTGAAAGTCTAATAAATTAGG + Intergenic
1203452823 Un_GL000219v1:136471-136493 TTCTGCAAGTAAAATAAAATTGG - Intergenic
1185775936 X:2803102-2803124 TTCTGTAAAAATATTAAATTTGG - Intronic
1186800177 X:13084715-13084737 TTGTGCAAATAGCATTAATTGGG + Intergenic
1188081654 X:25849952-25849974 ATGTGCAAATCAAATGAATTTGG + Intergenic
1188696331 X:33196234-33196256 TTCAGCAAATAAAATAACTTTGG - Intronic
1189091552 X:38088675-38088697 TGGTGCACATTTAATAAATGTGG - Intronic
1190068066 X:47256398-47256420 TTGAGCAAAAAGAATAAAGTTGG - Intergenic
1190243065 X:48672779-48672801 TTCTAAAAATATAAAAAATTAGG + Intergenic
1192120590 X:68451443-68451465 TAGAGCAAATATAAGAAATAAGG + Intergenic
1193280614 X:79644427-79644449 TTTTGCAAATATAAACACTTAGG - Intergenic
1193449686 X:81650323-81650345 TTCTGGTAAAATAATAAATTTGG + Intergenic
1193765499 X:85524079-85524101 CTGTGCCCATAGAATAAATTTGG + Intergenic
1194166531 X:90522780-90522802 TTGTGAAAGAAAAATAAATTTGG + Intergenic
1194739296 X:97553268-97553290 TTGTGAATATTTAATTAATTAGG - Intronic
1195376584 X:104233963-104233985 TTGTACAAATTTCATAAATGTGG + Intergenic
1195485838 X:105405418-105405440 TTCAGAAAATATAATATATTTGG + Intronic
1195901055 X:109797722-109797744 TTGTGCAAAGATAAGACATCTGG - Intergenic
1196133191 X:112179758-112179780 TATTTCAAATATAATATATTAGG + Intergenic
1196566796 X:117216353-117216375 CTGAGCAAAAATAATAAAGTTGG + Intergenic
1196586166 X:117430850-117430872 TTGTTGAAATATAATAATTTAGG + Intergenic
1197451099 X:126619636-126619658 TTGTGGAAAAATAATATTTTAGG + Intergenic
1198591767 X:138190913-138190935 TTCTGCAAATCTATTAAAGTAGG - Intergenic
1199174724 X:144773868-144773890 TTCTGAAAGTAAAATAAATTTGG + Intergenic
1200512799 Y:4100561-4100583 TTGTGAAAGAAAAATAAATTTGG + Intergenic
1200661584 Y:5965489-5965511 TTGTTCAATTAAATTAAATTAGG + Intergenic
1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG + Intergenic