ID: 1164009434

View in Genome Browser
Species Human (GRCh38)
Location 19:21186630-21186652
Sequence GTATATACAGAGAATTTGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164009434 Original CRISPR GTATATACAGAGAATTTGCT TGG (reversed) Exonic
902634051 1:17723645-17723667 GTATTTATTGAGCATTTGCTAGG + Intergenic
902674387 1:17998560-17998582 GTCTCTACAGAAAATTAGCTGGG - Intergenic
903375212 1:22861514-22861536 GTATTTACAGAGCACTTGCTGGG + Intronic
903991561 1:27274329-27274351 GAAAATACAGAGAACTGGCTGGG + Intronic
904713175 1:32447132-32447154 ATATATACAAAAAATTAGCTGGG - Intergenic
905039100 1:34938648-34938670 ATATATAAAGAAAATTTGATAGG - Intergenic
905559721 1:38916905-38916927 CTATATACAGAGATTATCCTGGG + Intronic
905560336 1:38921650-38921672 TTATTTTCAGAAAATTTGCTGGG - Intronic
905829088 1:41049893-41049915 ATCTCTACAGAAAATTTGCTAGG + Intronic
907398626 1:54210199-54210221 GGATATACTAAGAACTTGCTAGG + Intronic
907903970 1:58767295-58767317 GAATATAAATAGAAGTTGCTGGG + Intergenic
908834039 1:68210645-68210667 GGAGAAACAGAGATTTTGCTTGG - Intronic
911569045 1:99500294-99500316 ATATATACACACAATTAGCTGGG - Intergenic
913336386 1:117712462-117712484 GTAGAGTCTGAGAATTTGCTTGG + Intergenic
913578422 1:120200555-120200577 GAAAATACAAAGAATTAGCTGGG + Intergenic
913596136 1:120378972-120378994 GTATATACTGAGAAATTGCTTGG - Intergenic
913629750 1:120697796-120697818 GAAAATACAAAGAATTAGCTGGG - Intergenic
914091142 1:144500004-144500026 GTATATACTGAGAAATTGCTTGG + Intergenic
914307462 1:146434191-146434213 GTATATACTGAGAAATTGCTTGG - Intergenic
914560345 1:148811995-148812017 GAAAATACAAAGAATTAGCTGGG + Intronic
914594645 1:149138940-149138962 GTATATACTGAGAAATTGCTTGG + Intergenic
914612488 1:149318220-149318242 GAAAATACAAAGAATTAGCTGGG - Intergenic
915873401 1:159586496-159586518 TTAAATACAGACCATTTGCTTGG - Intergenic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
917932304 1:179831175-179831197 AGATATACAGAGGATGTGCTAGG + Intergenic
918082155 1:181215988-181216010 GTCTCTACAAAAAATTTGCTGGG - Intergenic
918244738 1:182648937-182648959 CTAAATACAAAGAATTAGCTGGG + Intronic
921192329 1:212721848-212721870 GCATATACGGAGAAGTGGCTGGG - Intergenic
921611086 1:217213406-217213428 ATATATACAAAAAATTAGCTGGG + Intergenic
921708915 1:218353726-218353748 GTCTCTACAGAGAATTTAGTTGG + Intronic
922108805 1:222537468-222537490 GTAAATACAAAAAATTAGCTGGG + Intronic
1063525817 10:6783999-6784021 GTATATACACACAATTCTCTTGG - Intergenic
1065184056 10:23155513-23155535 AAAAATACACAGAATTTGCTGGG + Intergenic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1068706657 10:60084243-60084265 GAAAATACAGAAAATTAGCTGGG + Intronic
1069180729 10:65355137-65355159 GTATATACACAGAGTTGACTTGG - Intergenic
1070227406 10:74524105-74524127 GTATATACAGGAAATTAGTTTGG - Intronic
1071388827 10:85149437-85149459 GTATATGCAGAGGATTTTATTGG - Intergenic
1073152715 10:101322792-101322814 TTATATAGACAGAATTAGCTCGG - Intergenic
1073658516 10:105445771-105445793 GTAAGGACAGAGAATATGCTTGG - Intergenic
1073826005 10:107322311-107322333 GTATAGACAGCGTATATGCTAGG + Intergenic
1074423503 10:113330195-113330217 ATATATACAAAAAATTAGCTGGG - Intergenic
1074822207 10:117188852-117188874 GCCTATGCAGAGACTTTGCTTGG + Intergenic
1075163518 10:120045201-120045223 AAATATACAGAAAATTAGCTGGG + Intergenic
1075309387 10:121399999-121400021 GTATCTACAAAAAACTTGCTAGG - Intergenic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1076144908 10:128110440-128110462 TCAAATTCAGAGAATTTGCTTGG - Exonic
1078362821 11:10682659-10682681 CCATATACAGAGAATTTCTTGGG - Intronic
1079302953 11:19295675-19295697 GTATTTACTGAGACTTTGCCAGG - Intergenic
1080538801 11:33246977-33246999 GTATATTAAGAAAATTTTCTGGG + Intergenic
1081822122 11:46009133-46009155 CTAAATACAGAAAATTAGCTGGG - Intronic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1085535956 11:77217889-77217911 CAATATACAGAGAAATTGCATGG + Intronic
1085596576 11:77816563-77816585 GTAAATACAGATAATGTGTTAGG - Intronic
1086806526 11:91250684-91250706 GAATATACAGAGATTTTCCTAGG - Intergenic
1087549486 11:99630270-99630292 GTATATACACATAATATGGTTGG + Intronic
1087887238 11:103495077-103495099 GTATATGCAGAGGATTTTATTGG - Intergenic
1088694481 11:112355131-112355153 GTGTCTACAGAGAACCTGCTGGG - Intergenic
1090525490 11:127530018-127530040 ATATACACTGAGAATTTACTAGG + Intergenic
1090991093 11:131817641-131817663 GTATATACAAAGGTTTTCCTGGG + Intronic
1091175225 11:133551816-133551838 GTAGATACAGATAGTTTCCTGGG - Intergenic
1091755959 12:3051797-3051819 GAAAATACAAAAAATTTGCTGGG - Intergenic
1092356207 12:7797516-7797538 CTAAATACAAAGAATTAGCTGGG - Exonic
1093215662 12:16358625-16358647 GAAAATACAGAAAATTAGCTGGG - Intronic
1093359377 12:18203953-18203975 ATAAATACAGAAAATTAGCTGGG + Intronic
1093850797 12:24035325-24035347 GTGTATATAGAGAATATGCTTGG - Intergenic
1094163287 12:27415184-27415206 TTATATACTGAAGATTTGCTAGG + Intronic
1095304797 12:40626517-40626539 GTCTCTACAAAAAATTTGCTGGG + Intergenic
1095338400 12:41058718-41058740 GTATCTGCACAGAATTTCCTTGG - Intronic
1095574790 12:43724447-43724469 AAATTTACTGAGAATTTGCTAGG + Intergenic
1096756000 12:53799994-53800016 GTATTTATAGAGCATTTACTAGG + Intergenic
1097810019 12:64008557-64008579 ATAAATATAGAGATTTTGCTTGG + Intronic
1098801451 12:74964473-74964495 GTATATAAAAAGAATGTTCTAGG + Intergenic
1103133090 12:118485580-118485602 TTAAATACAGAGAAATGGCTGGG + Intergenic
1105053406 12:133075813-133075835 GTAAATACAAAAAATTAGCTGGG + Intergenic
1105864593 13:24448034-24448056 GTCTCTACAGAAAATTAGCTGGG + Intronic
1106135485 13:26970246-26970268 ATATATACAAAAAATTAGCTGGG + Intergenic
1106741064 13:32641982-32642004 ATATTTATTGAGAATTTGCTTGG - Intronic
1107336028 13:39356166-39356188 GTATGGTCAGAGAATGTGCTTGG - Intronic
1107365390 13:39667637-39667659 GTATATATAGACAACTTACTTGG + Intronic
1109271652 13:60262244-60262266 GTAAAAACAGAGCATTTGCTAGG - Intergenic
1109458863 13:62627555-62627577 GTATATGCAGAGGATTTTATTGG + Intergenic
1110520653 13:76472293-76472315 GAAAATACAGAAAATTAGCTGGG - Intergenic
1111562794 13:89973627-89973649 GAAAATACAGAGAAGTTACTAGG + Intergenic
1112019261 13:95357560-95357582 GTTTTTAAAGATAATTTGCTGGG + Intergenic
1112247097 13:97745272-97745294 GTGTATGCAGAGAATTTTATTGG - Intergenic
1114056303 14:18969969-18969991 GAAAATACAAAGAATTAGCTGGG + Intronic
1114106248 14:19431757-19431779 GAAAATACAAAGAATTAGCTGGG - Intronic
1117028498 14:51646155-51646177 AAAAATACAGAAAATTTGCTGGG + Intronic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1117676401 14:58159136-58159158 GAAAATACAAAAAATTTGCTGGG - Intronic
1117859091 14:60070870-60070892 GTATAAACAGGGTATTTGCATGG + Intergenic
1118033074 14:61837396-61837418 GAATATACAAAAAATTAGCTGGG - Intergenic
1118259953 14:64237119-64237141 GAAAATACAAAAAATTTGCTGGG - Intronic
1121265235 14:92597838-92597860 ATATTTACTGAGACTTTGCTGGG + Intronic
1121859329 14:97301822-97301844 TTATATTCAGAGCATTTGCAGGG - Intergenic
1125067537 15:35507952-35507974 GTGTATACTGACAATTTTCTAGG - Intronic
1126893933 15:53237617-53237639 GAATATTCAGAGAATTGGCCTGG + Intergenic
1127144675 15:56012086-56012108 AAAAATACAGAAAATTTGCTGGG + Intergenic
1127150904 15:56074302-56074324 GTCTCTACAGAAAATTAGCTGGG + Intergenic
1127528542 15:59818373-59818395 TTATATACAATGAATTTTCTAGG + Intergenic
1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG + Intronic
1129933182 15:79429027-79429049 GTATTTAGAGAGAATTTGGGGGG + Intergenic
1131855551 15:96589839-96589861 GTATGTACACAGAATTTGTTTGG - Intergenic
1132083663 15:98888463-98888485 GTGTTTACAGAAAATATGCTAGG + Intronic
1132235593 15:100218039-100218061 GTATCTACAGAAAATTAGCTGGG - Intronic
1133633813 16:7647179-7647201 TTATATACAGAGCATATTCTGGG - Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1133851058 16:9504174-9504196 ATATTTACAGAGAACTTACTAGG - Intergenic
1135678402 16:24436742-24436764 GTATATGCAGAGGATTTTATTGG - Intergenic
1139009525 16:62615099-62615121 CTATATTCAGATAGTTTGCTTGG - Intergenic
1140854443 16:78965407-78965429 GTAAATACAAAAAATTAGCTGGG + Intronic
1141515072 16:84538460-84538482 GTATACACAGTGAAAATGCTGGG - Intronic
1143462139 17:7110484-7110506 GGATATACAGACACGTTGCTGGG - Intronic
1143957457 17:10683179-10683201 GTAGATGCAGAGAATTTCTTCGG - Intronic
1145039031 17:19563028-19563050 GAATAAACAGATAATTTTCTAGG + Intronic
1145811703 17:27768210-27768232 GAAAATACAGAAAATTGGCTGGG - Intronic
1145876675 17:28323835-28323857 GTCTCTACAGAAAATTAGCTGGG + Intronic
1146510193 17:33440473-33440495 GTAGATACCTAGAAATTGCTGGG + Intronic
1146518499 17:33508220-33508242 GCATTTACAGAGCATTTACTAGG + Intronic
1149096799 17:52851972-52851994 GTACTTAGAGAGAATGTGCTGGG - Intergenic
1149935085 17:60797053-60797075 AAAAATACAGAGAATTAGCTGGG - Intronic
1151401342 17:73857923-73857945 GCTTATACAGTGAATTTCCTGGG - Intergenic
1152347861 17:79764706-79764728 ATATATACAAAAAATTAGCTGGG + Intergenic
1154405717 18:14089204-14089226 TTTTATTCAGAGAATTTGATGGG + Intronic
1154946710 18:21168931-21168953 GTGTCTACAGAGTATTTGTTTGG - Intergenic
1155297068 18:24395162-24395184 GGAAATTCAGAGAACTTGCTAGG + Intronic
1155762721 18:29587701-29587723 GTGCACACAGAAAATTTGCTAGG + Intergenic
1156652141 18:39236876-39236898 CTAAAAACAGAGAATTGGCTGGG - Intergenic
1157321526 18:46638470-46638492 GTAAATACAAAAAATTAGCTGGG + Intronic
1161466798 19:4435536-4435558 GTTTCTACAGAAAATTAGCTGGG - Intronic
1161656204 19:5516810-5516832 GTATATAGAAAAAATTAGCTGGG - Intergenic
1161925947 19:7299834-7299856 CTAAATACAAAGAATTAGCTGGG + Intergenic
1164009434 19:21186630-21186652 GTATATACAGAGAATTTGCTTGG - Exonic
1164045876 19:21541012-21541034 ATAAATACAGAGAATTTGCATGG - Intronic
1164298647 19:23938518-23938540 GTTAAAACAGAGAATTTGCATGG - Intronic
1164514780 19:28924479-28924501 GTATAAACATAGAATTTGTTTGG - Intergenic
1165173523 19:33909990-33910012 GAAAATACAAAGAATTAGCTGGG + Intergenic
1165690722 19:37861170-37861192 GTACATAAAGAGAAGTTGGTTGG - Intergenic
1166620598 19:44296711-44296733 GTACATACAGAACATTTTCTAGG + Intronic
1166804436 19:45476869-45476891 ATATATACAAAAAATTAGCTAGG + Intronic
1166830411 19:45636129-45636151 AAATATACAAAAAATTTGCTGGG - Intronic
1167341773 19:48920847-48920869 GTCTCTACAGAAAATTGGCTGGG - Intronic
925604821 2:5648317-5648339 GTATATACTAAGAAATTGCTTGG - Intergenic
929522813 2:42670096-42670118 CTAAATACAAAGAATTAGCTGGG + Intronic
929645252 2:43619696-43619718 GTCTCTACAAAAAATTTGCTAGG - Intergenic
931017722 2:58004908-58004930 GTAACTGCAGAGAATTTGATAGG - Intronic
931303794 2:61007919-61007941 GAAAATACAGAAAATTAGCTGGG + Intronic
933660396 2:84922929-84922951 GAAAATACAAAGAATTAGCTGGG + Intergenic
934016769 2:87895332-87895354 GTAAATACTTAGAGTTTGCTGGG - Intergenic
934552341 2:95270160-95270182 GAATATGCTGAGAATATGCTGGG + Intergenic
937503652 2:122511763-122511785 AAATCTACAGAGAATTTGGTTGG + Intergenic
938046134 2:128122371-128122393 GAATATACAAAAAATTAGCTGGG + Intronic
939419547 2:141948136-141948158 GAATATACAAAAAATTAGCTGGG + Intronic
940418492 2:153450612-153450634 TTCTATCCAGAGAATTTTCTGGG - Intergenic
941151078 2:161916347-161916369 TTCTATATAGAGAATTTGCTAGG - Intronic
943779903 2:191812045-191812067 GAATAAAAAGAGAATATGCTAGG + Intergenic
944002670 2:194859857-194859879 GTTTCTACAGAGAATTTCCATGG + Intergenic
945108328 2:206338493-206338515 GTTTCTACAGAAAATTAGCTGGG + Intergenic
945137008 2:206640164-206640186 ATACATACACAGAATTAGCTTGG - Intergenic
945201538 2:207286582-207286604 GTAGAAACAGAGAATGTGATGGG - Intergenic
946585447 2:221181554-221181576 ATATATACAAAAAATTAGCTGGG - Intergenic
947943207 2:234076523-234076545 GTATGCACTGAGCATTTGCTGGG - Intronic
1169876577 20:10304063-10304085 GTTTATACACATAATGTGCTTGG - Intronic
1170947354 20:20903226-20903248 GTATTTACTGAGCATATGCTAGG - Intergenic
1171236302 20:23527866-23527888 GTATATAAAAGGAATTTACTAGG - Intergenic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1174740512 20:53009175-53009197 ATATATACAAAAAATTAGCTGGG + Intronic
1174957006 20:55109079-55109101 ATATATACATAGAAATGGCTAGG - Intergenic
1175850101 20:62085785-62085807 GAAAATACAAAGAATTAGCTGGG - Intergenic
1177634732 21:23772629-23772651 ATATAAATAGAGAATTTGATGGG - Intergenic
1178610940 21:34079347-34079369 GTATATAGACACAATTTTCTAGG + Intronic
1179675614 21:42979579-42979601 AAATATACAAAGAATTAGCTGGG + Intronic
1182319255 22:29467669-29467691 GTGTTTACTGAGAATTTTCTAGG + Intergenic
1183312957 22:37121329-37121351 ATATATACAGAAAATTAGCCGGG - Intergenic
1183994889 22:41625467-41625489 CTAAATACAGAAAATTTGCTGGG + Intronic
1184984923 22:48124662-48124684 CTAAATACAGAAAATTAGCTGGG - Intergenic
1185061837 22:48611092-48611114 GAATATACAAAAAATTAGCTGGG - Intronic
949643652 3:6068273-6068295 GAATATACAAAAAATTAGCTGGG - Intergenic
949649662 3:6141848-6141870 GAATATACAGAGAATGTTATAGG + Intergenic
949745634 3:7289109-7289131 ATTTTTACAGAGAATCTGCTTGG + Intronic
950028456 3:9836136-9836158 GTTTCTACAGAAAATTAGCTGGG + Intronic
950087748 3:10272597-10272619 GTAAATACAAAAAATTAGCTGGG - Intronic
950875411 3:16266937-16266959 GTATACACAGAGTATTTGACCGG - Intronic
952786301 3:37158861-37158883 ATATTTACTGAGAATTTGCAAGG + Intronic
952788511 3:37178623-37178645 GTCTCTACAGAAAATTAGCTGGG + Intronic
956023685 3:64959359-64959381 GTATCAATAGAGAATTTGATGGG + Intergenic
957448953 3:80351144-80351166 GTATATACAGACAGTTCTCTAGG - Intergenic
958116636 3:89227962-89227984 CTATGTACAGAGAATTTACAAGG + Intronic
958845000 3:99255638-99255660 CTATACAAAGAGAATTGGCTAGG + Intergenic
960670657 3:120152711-120152733 GTATCTACAAAAAATTAGCTGGG - Intergenic
960736973 3:120791858-120791880 GTATATACCTAGGAATTGCTGGG + Intergenic
960796989 3:121498013-121498035 GTAAATACAGAAAACTTGTTGGG + Intronic
961726042 3:128931334-128931356 GTCTCTACAGAAAATTAGCTGGG - Intronic
962782440 3:138732209-138732231 TTGTATACAGGAAATTTGCTAGG - Intronic
963355016 3:144200408-144200430 GTTTTTACAGAGAATTTGTGTGG - Intergenic
963900203 3:150726333-150726355 GGATACACAGAGAAGATGCTAGG + Intergenic
964447015 3:156769978-156770000 GTATATACTGAGACCCTGCTAGG - Intergenic
964602537 3:158517251-158517273 GTATTTACAGATAATTTGTTAGG - Intronic
964660742 3:159117501-159117523 GTATGTACAAAGCATATGCTAGG + Intronic
965361628 3:167747481-167747503 GAAAATACAGAAAATTAGCTGGG + Intronic
965980996 3:174690587-174690609 GCATAAAAATAGAATTTGCTGGG - Intronic
968033187 3:195521152-195521174 GAAAATACAAAAAATTTGCTGGG + Intronic
969832987 4:9813504-9813526 ATATATAAAGAGAATGTGATGGG - Intronic
970271565 4:14353627-14353649 ACATATACAGAGAATATTCTCGG - Intergenic
971639518 4:29113087-29113109 GTACATCTAGAGAATTTGTTTGG + Intergenic
972118044 4:35663137-35663159 GTTTGCACAGAGAATGTGCTAGG + Intergenic
972357768 4:38297083-38297105 ATATATACAAAAAATTAGCTGGG - Intergenic
973800139 4:54469628-54469650 AAATATACAGAAAATTAGCTGGG - Intergenic
974161273 4:58143392-58143414 GTATTTACTGAGAATCTGGTAGG - Intergenic
975055300 4:69923219-69923241 GTATATACATAGAAAATGTTTGG - Intergenic
975695034 4:77004122-77004144 GAATTAAGAGAGAATTTGCTTGG + Intronic
977005291 4:91561111-91561133 GTATATACAGAGGATATTCCAGG - Intronic
978484698 4:109238757-109238779 GGATATACAGAGAATGGGCTAGG - Intronic
978720687 4:111905248-111905270 GTATTTGCAGAGAATTTCCAGGG - Intergenic
979352791 4:119665158-119665180 GTATATAAAGATAGTTTTCTGGG - Intergenic
979783202 4:124682036-124682058 GTGCATACACAGCATTTGCTAGG - Intronic
980836112 4:138194606-138194628 GTATATATAGACATTTTTCTTGG - Intronic
981059646 4:140408963-140408985 ATATACACAGGGGATTTGCTGGG + Intronic
981456087 4:144954578-144954600 ATATATAAAGAGATTTTACTAGG + Intergenic
982143154 4:152350045-152350067 GTATATTCTGAGACTTTGCATGG + Exonic
982494394 4:156072306-156072328 ACATAGAAAGAGAATTTGCTTGG + Intergenic
984230816 4:177096667-177096689 GTATTTACAGACAATATTCTTGG + Intergenic
984323165 4:178219944-178219966 GTTTAAACAAACAATTTGCTGGG + Intergenic
985216125 4:187656294-187656316 GCATATACTTAGACTTTGCTAGG - Intergenic
985940303 5:3130221-3130243 TTATACAAAGAGACTTTGCTTGG - Intergenic
986936933 5:12900625-12900647 GTAGATACAAAAAATTAGCTGGG + Intergenic
987597978 5:20025829-20025851 TGATATAAAAAGAATTTGCTGGG - Intronic
987772671 5:22326719-22326741 GTATAGACACAGAATTTGACAGG - Intronic
987857950 5:23445671-23445693 TTATAAACAGAGAATTTGGTAGG + Intergenic
988215361 5:28265140-28265162 GTTAATACAAAGAATTTGTTTGG + Intergenic
989165778 5:38432448-38432470 ATATATATAGAGCATTTTCTAGG - Intronic
990998046 5:61753116-61753138 GTATAAACAGAGATTGTTCTGGG - Intergenic
991496767 5:67234639-67234661 GTATTTAGTGAGAATTTCCTGGG - Intergenic
991976968 5:72193123-72193145 GTATCTGCAGAGAATATGCTGGG + Intronic
993322237 5:86486118-86486140 GTAGATAAAGTGAATTTACTTGG + Intergenic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
994224905 5:97240488-97240510 GTATATAGAGTGAATTGGTTTGG + Intergenic
995046155 5:107650840-107650862 GTATATACAACCAAATTGCTAGG - Intronic
996244652 5:121246909-121246931 GTAGATACAGATGATTTGATAGG + Intergenic
997059535 5:130484725-130484747 GTGTCTACTGAAAATTTGCTAGG - Intergenic
998223486 5:140307151-140307173 ATATACACAGAGCATTTTCTAGG - Intergenic
998339124 5:141400558-141400580 GTAAATACAGAAAATTGGGTGGG - Intronic
998867541 5:146520388-146520410 GTAGAGACACAAAATTTGCTGGG + Intergenic
999361432 5:150989528-150989550 GTATATACAGGGTGTATGCTGGG + Intergenic
999766183 5:154742567-154742589 ATATATACAAAAAATTAGCTGGG + Intronic
1000153491 5:158527275-158527297 CTAAATACAGAAAATTAGCTGGG + Intergenic
1000510740 5:162179165-162179187 GTATATACATAACATTTTCTAGG - Intergenic
1003258721 6:4496726-4496748 GTATTTCCAGAGCATTTGCCTGG + Intergenic
1003298022 6:4851560-4851582 GTAGAAACAGACGATTTGCTCGG + Intronic
1005073885 6:21888426-21888448 GTAAATACAAAAAATTAGCTGGG - Intergenic
1005342382 6:24855292-24855314 GTATACACAGAAAAGTTGGTTGG + Intronic
1005720238 6:28594352-28594374 ATATATAAAGAAAATGTGCTAGG + Intronic
1007900827 6:45410596-45410618 GTATATACATGGAATATGGTAGG + Intronic
1008668638 6:53743630-53743652 ATATATACAAAAAATTAGCTGGG - Intergenic
1008860232 6:56140317-56140339 GAATATACATAGATTTTGCAGGG - Intronic
1010471423 6:76232891-76232913 GTATTTACTGAGAATTAGCTGGG - Intergenic
1012685331 6:102240630-102240652 CTATATACAGAGAGAGTGCTGGG - Intergenic
1013941950 6:115675061-115675083 GAAAATACAAAGAATTAGCTGGG - Intergenic
1014619621 6:123649772-123649794 TAATATACTGATAATTTGCTAGG + Intergenic
1016587238 6:145703250-145703272 GAAAATACAGAAAATTAGCTGGG - Intronic
1016812569 6:148275376-148275398 GTACATACAAATAATTTTCTTGG - Intronic
1017944492 6:159082924-159082946 CTAAATACAAAGAATTAGCTGGG + Intergenic
1017966045 6:159267170-159267192 GCATATACACAGAAATTGCTAGG - Intronic
1019110957 6:169713437-169713459 AAATATACAGAAAATTAGCTGGG + Intronic
1019677817 7:2325670-2325692 ATATATACAAAAAATTAGCTGGG + Intronic
1019726232 7:2604277-2604299 GTCTCTACAGAAAATTAGCTGGG - Intronic
1020067037 7:5196176-5196198 CTAAATACAAAAAATTTGCTGGG + Intronic
1020355924 7:7275580-7275602 GTATATCCTTAGGATTTGCTCGG - Intergenic
1020623993 7:10556017-10556039 GTATACACAGAATATTTTCTAGG + Intergenic
1020937746 7:14488665-14488687 GTATATATATAAAATTAGCTCGG + Intronic
1021004916 7:15382336-15382358 GTATATACGAGGAATGTGCTCGG + Intronic
1021491957 7:21228611-21228633 CTTTATACAGAGAATTACCTAGG - Intergenic
1023639529 7:42243318-42243340 AATTATACAGAGAATTTGGTAGG + Intergenic
1024379268 7:48675930-48675952 GAATCTACAGAGAATTTACAAGG + Intergenic
1027418685 7:77998832-77998854 GTACATGCAGAGAGTTGGCTTGG + Intergenic
1027825525 7:83110079-83110101 GTATGTACTGAGAACCTGCTTGG - Intronic
1028318673 7:89435190-89435212 GTATATACAGGGTGTATGCTGGG - Intergenic
1028698652 7:93749088-93749110 CTATGTACTGAGAATTTTCTCGG - Intronic
1028831514 7:95332396-95332418 TTATTTACAGACAATGTGCTTGG + Intergenic
1028986733 7:97015384-97015406 ATGAATACAGAGAATTTCCTAGG + Intergenic
1029158342 7:98533259-98533281 GTATATACAAAAAATTAGCATGG + Intergenic
1029464082 7:100714655-100714677 GTCTCTACAGAAAATTTGTTAGG - Intergenic
1029800458 7:102941426-102941448 GTTTTTAAAGATAATTTGCTAGG - Intronic
1030184399 7:106746656-106746678 GGGTATACAGTGAAATTGCTGGG - Intergenic
1030281741 7:107783034-107783056 GAGTATTCAGAGGATTTGCTGGG - Exonic
1031983284 7:128144301-128144323 ATAAATACAAAAAATTTGCTGGG + Intergenic
1032275261 7:130449252-130449274 GTATACACAAAGAAATGGCTTGG + Intergenic
1034685486 7:152967319-152967341 GTAAATACAGAAAACTTGTTTGG + Intergenic
1035165428 7:156986713-156986735 GAAAATACAGAAAATTAGCTGGG + Intergenic
1036225431 8:6953912-6953934 GTATAGACAGAAAATCTGCAGGG + Intergenic
1038390402 8:27193237-27193259 GAATACACAGAGCATTTGGTAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038895766 8:31780106-31780128 TTATAAACAGAGGATTTACTGGG + Intronic
1039189677 8:34958797-34958819 GTATATACCAAGAAGTTGCCGGG + Intergenic
1040011453 8:42664352-42664374 GGATATACAAAGAATTTTCCTGG - Intergenic
1040463719 8:47675195-47675217 CTAAATACAGAAAATTAGCTGGG - Intronic
1040890043 8:52307873-52307895 GGATATACTGATATTTTGCTTGG + Intronic
1041546034 8:59044031-59044053 CTATATACAGAGAATTTGGTGGG - Intronic
1041629637 8:60072142-60072164 CTTTATAAAGAGAATTTTCTGGG - Intergenic
1042101252 8:65277814-65277836 GCATATACAGAGAATATTATAGG + Intergenic
1042493805 8:69433646-69433668 GTAAATATAGAAAATTGGCTTGG - Intergenic
1042583920 8:70314017-70314039 ATATATACAAAAAATTAGCTTGG + Intronic
1043049318 8:75364748-75364770 CTATAGAGAGAGGATTTGCTGGG + Intergenic
1043273851 8:78368541-78368563 GTACATAAAGAGAATTAGTTGGG - Intergenic
1044218873 8:89646556-89646578 AAATATACAGAAAATTAGCTGGG - Intergenic
1044866586 8:96576712-96576734 GTATATAAAGAGAATAGGCCGGG - Intronic
1044914051 8:97093300-97093322 GTATACACACAGCATTTGCTGGG - Intronic
1048665840 8:136660398-136660420 ATATCTACAAAGATTTTGCTGGG - Intergenic
1049856080 8:144862785-144862807 GTACATACAGGGTATATGCTGGG + Intergenic
1050960634 9:11725627-11725649 ATATTTACTGAGTATTTGCTAGG - Intergenic
1051934325 9:22426730-22426752 GAATATGCAGAAAATTTTCTGGG + Intergenic
1053099850 9:35362637-35362659 GTAAATACAAAAAATTAGCTGGG + Intronic
1053211738 9:36234924-36234946 GTATATAGAGAGAAGTGGCCAGG - Intronic
1056696992 9:88866976-88866998 TTATATATACAGAATGTGCTAGG + Intergenic
1057979173 9:99641528-99641550 ATATATACAAAAAATTAGCTGGG - Intergenic
1058183399 9:101824952-101824974 TTATATAAAGAGAATTTCATGGG - Intergenic
1060002628 9:119972246-119972268 GTATATACACTGAATTTTCCTGG + Intergenic
1060722400 9:125987692-125987714 GCAGACAAAGAGAATTTGCTGGG + Intergenic
1060808335 9:126593033-126593055 GAAAATACAAAAAATTTGCTGGG + Intergenic
1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG + Intronic
1186925958 X:14333705-14333727 GTAGAAACAGAGAATGTTCTAGG - Intergenic
1186951672 X:14633198-14633220 GTAAATACAATGAATTGGCTAGG + Intronic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1188501211 X:30828812-30828834 GTATGTACAGACAATTGGCATGG - Exonic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190777942 X:53569185-53569207 GTCTCTACAGAAAATTAGCTGGG - Intronic
1192873514 X:75206632-75206654 GTATATACAGGGAGTATGCTGGG + Intergenic
1194718068 X:97309661-97309683 GTAGATACAGATAAGTTACTGGG - Intronic
1196236717 X:113290009-113290031 GTATATACATAGTAAGTGCTTGG - Intergenic
1197533918 X:127663870-127663892 GGAGATACAGAGGAGTTGCTGGG + Intergenic
1197552899 X:127916833-127916855 CTATAAAGAGAGAATTAGCTGGG + Intergenic
1197955733 X:131945602-131945624 GTATATACAGAATAGTTGGTGGG - Intergenic
1198679962 X:139170759-139170781 ACATATCCAGAGAATTAGCTAGG - Intronic
1199015193 X:142806676-142806698 ATATATACAAAAAATTAGCTGGG - Intergenic
1199093710 X:143717486-143717508 GTATATACAGGGTGTATGCTGGG - Intronic
1199127714 X:144143208-144143230 GTAAATACTTAGAGTTTGCTGGG + Intergenic
1199254269 X:145700588-145700610 TTATTTACAGAGAATATTCTGGG + Intergenic
1199373550 X:147081107-147081129 GTATATACAAACAATATGATAGG + Intergenic
1199386780 X:147232303-147232325 GAAAATACAGAAAATTAGCTGGG - Intergenic
1200219059 X:154381754-154381776 GTATATACAGAGAACCCACTTGG + Intergenic
1201773456 Y:17640651-17640673 ATATATTCAAAGAAATTGCTTGG - Intergenic
1201828099 Y:18265335-18265357 ATATATTCAAAGAAATTGCTTGG + Intergenic