ID: 1164010531

View in Genome Browser
Species Human (GRCh38)
Location 19:21199757-21199779
Sequence GGATTTGAACATATGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164010530_1164010531 -7 Left 1164010530 19:21199741-21199763 CCTTCTGTTTTTTTTAGGATTTG No data
Right 1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG No data
1164010527_1164010531 21 Left 1164010527 19:21199713-21199735 CCTCTCTTGTGTCAAACCACTGC No data
Right 1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG No data
1164010528_1164010531 5 Left 1164010528 19:21199729-21199751 CCACTGCAGACTCCTTCTGTTTT No data
Right 1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164010531 Original CRISPR GGATTTGAACATATGCAGCA TGG Intergenic
No off target data available for this crispr