ID: 1164010707

View in Genome Browser
Species Human (GRCh38)
Location 19:21201264-21201286
Sequence ACTCGGTAAGGTCTACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164010702_1164010707 0 Left 1164010702 19:21201241-21201263 CCAGTAACCTCCTGCTCAAGGCA No data
Right 1164010707 19:21201264-21201286 ACTCGGTAAGGTCTACAAGCAGG No data
1164010704_1164010707 -7 Left 1164010704 19:21201248-21201270 CCTCCTGCTCAAGGCAACTCGGT No data
Right 1164010707 19:21201264-21201286 ACTCGGTAAGGTCTACAAGCAGG No data
1164010700_1164010707 30 Left 1164010700 19:21201211-21201233 CCGAGAAGGTGAAACAAACACTA No data
Right 1164010707 19:21201264-21201286 ACTCGGTAAGGTCTACAAGCAGG No data
1164010705_1164010707 -10 Left 1164010705 19:21201251-21201273 CCTGCTCAAGGCAACTCGGTAAG No data
Right 1164010707 19:21201264-21201286 ACTCGGTAAGGTCTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164010707 Original CRISPR ACTCGGTAAGGTCTACAAGC AGG Intergenic