ID: 1164014039

View in Genome Browser
Species Human (GRCh38)
Location 19:21236159-21236181
Sequence CTGGACACACAGATAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 16, 3: 54, 4: 451}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164014033_1164014039 10 Left 1164014033 19:21236126-21236148 CCCTACAGGGAAACCCTGATCTA 0: 1
1: 0
2: 4
3: 15
4: 155
Right 1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG 0: 1
1: 0
2: 16
3: 54
4: 451
1164014032_1164014039 22 Left 1164014032 19:21236114-21236136 CCTTAGGAAAATCCCTACAGGGA 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG 0: 1
1: 0
2: 16
3: 54
4: 451
1164014034_1164014039 9 Left 1164014034 19:21236127-21236149 CCTACAGGGAAACCCTGATCTAA 0: 1
1: 0
2: 3
3: 19
4: 150
Right 1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG 0: 1
1: 0
2: 16
3: 54
4: 451
1164014036_1164014039 -4 Left 1164014036 19:21236140-21236162 CCTGATCTAATATCAATAACTGG 0: 1
1: 1
2: 3
3: 16
4: 89
Right 1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG 0: 1
1: 0
2: 16
3: 54
4: 451
1164014035_1164014039 -3 Left 1164014035 19:21236139-21236161 CCCTGATCTAATATCAATAACTG 0: 1
1: 1
2: 3
3: 13
4: 148
Right 1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG 0: 1
1: 0
2: 16
3: 54
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164014039 Original CRISPR CTGGACACACAGATAGAAAA GGG Intronic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
902603009 1:17552824-17552846 CAGGTCACACAGCTAGTAAATGG + Intronic
902632856 1:17715950-17715972 AGGGGCACACAGATAGTAAATGG + Intergenic
903589513 1:24443821-24443843 CAGAACACAAATATAGAAAATGG - Intronic
903761641 1:25702615-25702637 CAGGTCACACAGCCAGAAAATGG - Intronic
904810418 1:33160024-33160046 CTTGACACACAGAGAGGAAAGGG + Intronic
905324500 1:37141170-37141192 CTGGCCATAAAGGTAGAAAAGGG - Intergenic
905456576 1:38092313-38092335 AAGGAGACACAGTTAGAAAAGGG + Intergenic
905863343 1:41364327-41364349 CTGGTCACACAGTTAGTAGATGG + Intronic
907026992 1:51129749-51129771 CTGAAAACACAGCAAGAAAAAGG - Intronic
907980728 1:59478027-59478049 CTGGTCACAAAGGTAGTAAATGG - Intronic
908484326 1:64575813-64575835 GTGGGCACATAGTTAGAAAAAGG - Intronic
909618697 1:77643043-77643065 CTGTACAAAAAAATAGAAAAAGG + Intronic
909822148 1:80079211-80079233 ATGGTAACACAGATAGCAAAAGG + Intergenic
910578572 1:88795658-88795680 CAGGCCACACAGCTAGAAAGTGG + Intronic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
913225052 1:116691774-116691796 CTGAGCACACAGGTAGGAAAAGG - Intergenic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
914259372 1:145985997-145986019 CTGGACAGATGGATAGAACAAGG - Intergenic
915267689 1:154730852-154730874 CTGCACACCCAGACAGCAAAAGG + Intronic
916269051 1:162920223-162920245 CTGCTCTCACAGAGAGAAAAAGG - Intergenic
916349094 1:163828552-163828574 AAGGTCACACAGCTAGAAAATGG + Intergenic
918605680 1:186422928-186422950 CGGGACACAAAGATTGAAAAAGG + Intergenic
919982250 1:202649562-202649584 AAGGTCACACAGTTAGAAAAGGG + Intronic
920124649 1:203683989-203684011 CTGGACACTGATACAGAAAAAGG - Intronic
920245005 1:204580770-204580792 CTAGAAAGCCAGATAGAAAAGGG - Intergenic
920317432 1:205087776-205087798 CTGAAAACACAGTAAGAAAAAGG + Exonic
920394366 1:205632913-205632935 CAGGTCACACAGCTAGTAAATGG - Intergenic
923610428 1:235487513-235487535 GAGGTCACACAGCTAGAAAATGG + Intronic
924036862 1:239946478-239946500 TTGGACACAGAGACACAAAATGG + Intergenic
924041879 1:239991963-239991985 TTGGACACAGAGACACAAAAAGG - Intergenic
924124725 1:240838428-240838450 CAGGACACACATACAGAGAAAGG + Intronic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1064618284 10:17186459-17186481 CTGGCTTCAAAGATAGAAAAAGG + Intronic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065772071 10:29086987-29087009 GTGAACACACAGAGAGAAGAAGG - Intergenic
1065832320 10:29625995-29626017 CTGAACTCACAGAAACAAAATGG + Intronic
1066336292 10:34481573-34481595 CTGGCCACCCAGAGAGCAAATGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067788350 10:49269565-49269587 CTGGACATACAGATAGGCAGTGG - Intergenic
1067907579 10:50309716-50309738 CAGGGCACTGAGATAGAAAAGGG - Intronic
1068012950 10:51477489-51477511 AGGGACACACAGCTAGTAAATGG - Intronic
1068548167 10:58376052-58376074 CTGGAGACACACATTTAAAAAGG - Intergenic
1069087340 10:64156569-64156591 CTTGAAAGACAGATAGAAATGGG - Intergenic
1069928368 10:71866572-71866594 AAGGACACACCGCTAGAAAATGG + Intergenic
1070636936 10:78136498-78136520 AAGGACACACAGCTAGAAAAGGG - Intergenic
1071330086 10:84550302-84550324 CAGGGCCCACAGCTAGAAAATGG - Intergenic
1071447815 10:85765180-85765202 ATGGTCACACAGCAAGAAAATGG + Intronic
1071458185 10:85867429-85867451 CTGGCCCCACAGAGAGCAAAGGG + Intronic
1073679674 10:105689055-105689077 CTTGACACATAGAAAGAACAAGG - Intergenic
1074177745 10:111027509-111027531 AAGGACACACACATACAAAAAGG - Intergenic
1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG + Intergenic
1076365324 10:129918067-129918089 CTGGTCACACAGTTAGGAAGGGG + Intronic
1078044700 11:7903145-7903167 CTGGAAAAACAGATAGCTAAGGG - Intergenic
1078492192 11:11779838-11779860 CAGAACACACAGCTAGTAAATGG + Intergenic
1078788408 11:14519804-14519826 CTGGACAAAATGATTGAAAAGGG + Intronic
1079197321 11:18340772-18340794 AGGGTCACACAGATAGAAAGTGG + Intronic
1079619428 11:22535170-22535192 CTGGACACTGAGAGAGAAGAAGG - Intergenic
1080298515 11:30757776-30757798 CTGGTCACACAGCTAGAAAGTGG + Intergenic
1081940526 11:46937358-46937380 TAGGCCACACAGCTAGAAAATGG + Intronic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1083650714 11:64202978-64203000 AAGGACACACAGGTAGACAAAGG - Intronic
1084537032 11:69763364-69763386 CTGGACACACAGACACACAGAGG + Intergenic
1084590439 11:70086927-70086949 CTGGACACACAGCTAGTTAGTGG + Intronic
1084920516 11:72465693-72465715 CTGGAGAAACCCATAGAAAAAGG - Intergenic
1085257039 11:75180855-75180877 CTGGTCACATAGCTAGTAAATGG + Intronic
1085517934 11:77122191-77122213 CTGGGCACATAGAGAGGAAAAGG + Intronic
1085754843 11:79193804-79193826 AAGGTCACACAGCTAGAAAATGG + Intronic
1085822995 11:79813028-79813050 CTGGGGAAACAGATATAAAATGG + Intergenic
1086366605 11:86113398-86113420 CTTGGCACATAGATAGAAGATGG - Intergenic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1087499519 11:98932659-98932681 CAAGACAAACAGATAAAAAAGGG - Intergenic
1087605196 11:100368810-100368832 AAGGACACACAGATATAAAGTGG + Intergenic
1088246369 11:107821862-107821884 GTGGACAAACAGGTAGAAGATGG + Intronic
1088556934 11:111071306-111071328 ATGGACATACAGAGAGAAGATGG + Intergenic
1089064830 11:115654484-115654506 CTAGCCACACAGCTAGAAAGTGG - Intergenic
1090448274 11:126783281-126783303 AGGGACACACAGAGAGAAGAGGG - Intronic
1090485791 11:127110855-127110877 CAGCAGACACAGATATAAAAGGG - Intergenic
1091541466 12:1466288-1466310 CTGGACATACAGAAAGACACTGG - Intronic
1091580877 12:1788281-1788303 GTAGACACACACATAGAAATGGG - Exonic
1091865042 12:3826158-3826180 CTGAAAGCACTGATAGAAAAGGG + Exonic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1092896350 12:13014587-13014609 CTGATCACACAGATATTAAAAGG - Intergenic
1093564595 12:20587867-20587889 CCTGACATACAGATAGAAAAAGG + Intronic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1096765729 12:53887443-53887465 CATGGCACACATATAGAAAAAGG - Intergenic
1097781659 12:63713799-63713821 CTGTACACTCATCTAGAAAATGG - Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098772139 12:74566036-74566058 TAGTACACACATATAGAAAAGGG + Intergenic
1100125992 12:91425759-91425781 CTATACACACATATACAAAATGG - Intergenic
1101331661 12:103762251-103762273 CTGAACACAAAGAAAGGAAAGGG - Intronic
1101717577 12:107323987-107324009 AAGAACACACAGCTAGAAAATGG - Intronic
1102772603 12:115491517-115491539 GTGGTCACACAGGTAGAAAGTGG + Intergenic
1102788992 12:115628259-115628281 CTTGACAGAGAGAGAGAAAATGG + Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1103141218 12:118550013-118550035 CTCCACCCACAGACAGAAAAAGG - Intergenic
1103187671 12:118974794-118974816 AGGGACACACAGTTAGTAAAAGG - Intergenic
1103210955 12:119166044-119166066 CAGGTCACACAGATAGTAAGTGG + Intergenic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1105826005 13:24124046-24124068 CTGGACACACAGAAAGCAATGGG + Intronic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106888713 13:34218990-34219012 CTTGAGACACAGACAGAAAATGG + Intergenic
1106939481 13:34762099-34762121 ATGGGCACACAGCTAGAAAATGG - Intergenic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1108830823 13:54476139-54476161 CTGGGCAAGCAGAAAGAAAAAGG - Intergenic
1109384090 13:61604642-61604664 GTGGGAACACAGATAGAAGATGG + Intergenic
1109751570 13:66699516-66699538 GAGGAGACACAGAGAGAAAAGGG + Intronic
1110049443 13:70875938-70875960 CAGGACACAGAGATTCAAAAGGG + Intergenic
1110174926 13:72544906-72544928 CATCACACACAGATAGAAATAGG + Intergenic
1111594852 13:90398512-90398534 CTGGACACTCATATAAAGAAAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1112645650 13:101328597-101328619 AGGGTCACACAGATAGAAAGTGG - Intronic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115528460 14:34304343-34304365 TTAGACACACAGAAAGAAACAGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1118509453 14:66455021-66455043 GTGGTCACACAGGTAGCAAATGG + Intergenic
1118574581 14:67229130-67229152 CAAGTCACACAGCTAGAAAATGG + Intergenic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1119731091 14:76951516-76951538 TTGGACACACAGAGAGAAAATGG - Intergenic
1120016796 14:79483002-79483024 GTGCACACACAGCTTGAAAAAGG - Intronic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120329883 14:83078714-83078736 TTGGAAACACAAATAGGAAAAGG + Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1120749523 14:88185210-88185232 CTGGGCACACACGTAGACAAGGG - Exonic
1120818346 14:88887103-88887125 CTGGAAAGAAAGATACAAAATGG + Intergenic
1120928649 14:89824445-89824467 CTGGAAATAAAGGTAGAAAAGGG + Intronic
1125681884 15:41536118-41536140 CGGGACACACAGGTAGGCAAGGG - Exonic
1126084476 15:44998962-44998984 CTGAACACACAATTTGAAAAAGG - Intergenic
1126916421 15:53471443-53471465 CTGGACACAAATAGAGAAGACGG - Intergenic
1126932490 15:53670508-53670530 CTGGACAGATAGAAAGAACATGG - Intronic
1127556705 15:60094673-60094695 CAAGGCACACAGATAGTAAATGG - Intergenic
1127978632 15:64017611-64017633 CTGGAGACACAGCTAGGAAGAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128455319 15:67828431-67828453 CCAGACACAGAGACAGAAAAGGG + Intronic
1128721511 15:69954008-69954030 GGGGTCACACAGATAGGAAATGG + Intergenic
1130418411 15:83715789-83715811 CAGGGCACACAGAGAGAAATGGG - Intronic
1130776370 15:86988171-86988193 CTGGACAAAGAGAAAGTAAATGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131651803 15:94408211-94408233 CTGCACACACACCTAGCAAATGG - Intronic
1131775178 15:95787664-95787686 CTTGCCACACACATACAAAATGG - Intergenic
1131982339 15:98006278-98006300 CTGGAGACAGTGATAGAAACAGG - Intergenic
1132166462 15:99596733-99596755 CAGGACATTCAGGTAGAAAAAGG - Intronic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1135501081 16:22996390-22996412 TTGGACACACAGGGAGAAGATGG - Intergenic
1135523369 16:23194405-23194427 ATGGAAACACTGATAGAAAAAGG - Intronic
1135717748 16:24787042-24787064 ATGGTCACACAGCTAGTAAATGG + Intronic
1135782921 16:25322014-25322036 CCCGACACACACATAGAAAGGGG - Intergenic
1135836139 16:25827034-25827056 ATGGACTCAAAGATAGAAAATGG + Intronic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1137774660 16:51045035-51045057 TTGGACACACAGAGAGACACCGG + Intergenic
1138939123 16:61768468-61768490 AGGGTCACACAGATAGAAACTGG - Intronic
1139724806 16:68888580-68888602 CTGGAAACAGAGAGATAAAATGG - Intronic
1139799023 16:69506156-69506178 CTGGAATTACAGATAAAAAATGG + Intergenic
1139847316 16:69930107-69930129 CTGGAAACACGGGAAGAAAAGGG - Intronic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1141000215 16:80300730-80300752 CAGGAAACACAGAAAAAAAAAGG + Intergenic
1141538294 16:84699219-84699241 CTGAAATCACAGCTAGAAAAGGG + Intergenic
1143346001 17:6249728-6249750 CAGGACACACAGATAATAAATGG + Intergenic
1143885017 17:10058843-10058865 ATGGTCACACAGGTAGAAAGTGG + Intronic
1143974192 17:10818102-10818124 ATGGACACACAGGGAGAAGACGG + Intergenic
1144374041 17:14621355-14621377 CTGGTCACACAGAGAGCAAGTGG + Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146428155 17:32763389-32763411 CTTGCCACACAGATAACAAAGGG + Intronic
1147340802 17:39752290-39752312 CTGGTCCAACAGATAGAAAGAGG + Intergenic
1147476046 17:40712339-40712361 CTCTACACACAGAAAGATAATGG - Intergenic
1147502513 17:40979104-40979126 GTGGTCACATAGCTAGAAAAGGG - Intronic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148923185 17:51058429-51058451 AAAGTCACACAGATAGAAAATGG + Intronic
1150158898 17:62877312-62877334 AAGGGCACACAGCTAGAAAATGG - Intergenic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1151149864 17:72075942-72075964 CTAGACAGACTGGTAGAAAAGGG + Intergenic
1151422091 17:74005306-74005328 GAGGACACACTGATAGGAAAGGG - Intergenic
1153265411 18:3263897-3263919 CTTGCCACACAGCTAGAAAATGG - Intronic
1156460136 18:37316983-37317005 CAGGGCACACAGACAGAAAGTGG - Intronic
1156787158 18:40929297-40929319 GTGGACAGACACATAGATAATGG + Intergenic
1158269394 18:55696584-55696606 TTGGACAAATGGATAGAAAATGG - Intergenic
1158518264 18:58148606-58148628 TTGGACACACAGAGAGACACTGG - Intronic
1158720673 18:59921611-59921633 TTGGACTCAGAGATAGAACAGGG + Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161497722 19:4596736-4596758 CTGGACAAACAGCAAGAAAATGG + Intergenic
1161810163 19:6466896-6466918 CTGGACACACAGAGAAAAGTTGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162622924 19:11858839-11858861 GTGGGCAAACAGATAGAAAAGGG - Intronic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167874533 19:52400467-52400489 CTGGTGACTCAGATAAAAAAAGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168070288 19:53946343-53946365 CTGGTCACACAGCTAGTAAGCGG + Intergenic
1168348606 19:55662801-55662823 CAGGTCACACAGAAAGCAAATGG - Intronic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
1168680097 19:58308635-58308657 CTGGGCAAACAGATAGGAAAGGG + Intronic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
926108028 2:10164721-10164743 CTGGCCGCCCAGATAGGAAATGG - Intronic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
927368466 2:22326899-22326921 GTGCACACACAGAGAGAAGAAGG + Intergenic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
927627489 2:24737296-24737318 TTGCACACACAGATAGTCAAGGG + Intronic
928090497 2:28370869-28370891 CTGAACACAATGATAAAAAAGGG + Intergenic
929429678 2:41876689-41876711 CTGACCTCACAGAAAGAAAATGG + Intergenic
929902970 2:46021829-46021851 CTGGACACACACACACAAAAAGG - Intronic
929939994 2:46326353-46326375 CTGTACACAGTGAAAGAAAACGG + Intronic
930925312 2:56810934-56810956 CTGTCCACCCACATAGAAAACGG + Intergenic
931108195 2:59080887-59080909 CTAGACAGACAGAGAGAGAAAGG + Intergenic
932196136 2:69785702-69785724 CAGGTCACACAGCTAGAAAGAGG + Intronic
932638369 2:73413790-73413812 CTGGAAAAAAAGATAGCAAATGG - Intronic
932850550 2:75180391-75180413 CTGCAAACACTCATAGAAAAGGG - Intronic
933014064 2:77102044-77102066 CAGCACACACAGATAGTAACTGG - Intronic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
934615840 2:95770192-95770214 CTGGACACACAGATCGGCAGGGG + Intergenic
934648612 2:96073675-96073697 CTGGACACTCAGATAGCCCAGGG - Intergenic
935869338 2:107428086-107428108 GTGGAGACACAGAAAGAAACAGG + Intergenic
936140502 2:109935952-109935974 CAGGTCACACAGCTTGAAAATGG - Intergenic
936177193 2:110233897-110233919 CAGGTCACACAGCTTGAAAATGG - Intergenic
936204192 2:110435534-110435556 CAGGTCACACAGCTTGAAAATGG + Intronic
937426885 2:121807245-121807267 AAGGTCACACAGTTAGAAAATGG + Intergenic
937589715 2:123598376-123598398 CTGTACACAGATAAAGAAAAGGG + Intergenic
937786312 2:125903561-125903583 TTGGAAACAAAGATAGAAAGTGG - Intergenic
938076854 2:128344339-128344361 CAGGTCACACAGCTAGAGAATGG - Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938753517 2:134358488-134358510 CTGGACTCACAAATACAAAAAGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939977471 2:148735426-148735448 ATGGACCCAAAGATAGGAAAAGG - Intronic
940026238 2:149211395-149211417 ATGGTCACAGAGAAAGAAAATGG - Intronic
940287398 2:152046244-152046266 CTGTGCTCACATATAGAAAAGGG - Intronic
942168234 2:173263664-173263686 ATAGACACACATATATAAAATGG - Intronic
942341869 2:174957645-174957667 GTGGAGACACACATAGAATATGG - Intronic
942357040 2:175127419-175127441 GTGGACACAGAGAGAGAAATAGG - Intronic
942613483 2:177765536-177765558 CTGGTCACACAGGTAGGAAGGGG + Intronic
942867120 2:180690356-180690378 CTGAACAAACGGATAGAAAATGG + Intergenic
946020802 2:216638663-216638685 CTGTTCACACCCATAGAAAATGG + Intronic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
948507908 2:238442749-238442771 CTGGACATCCATATGGAAAAAGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1168830001 20:840719-840741 AGGGACACACAGCTAGAAAGTGG + Intronic
1168933767 20:1645702-1645724 CAGGTCACAGAGCTAGAAAATGG + Intronic
1169095107 20:2890752-2890774 GTGGCCACAAAGATAGAAAGAGG - Intronic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1171191907 20:23164797-23164819 CTGGACACAGAAGTGGAAAATGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1172949499 20:38713725-38713747 CTGGTCACACAGCTACAAAGCGG + Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1173128696 20:40365895-40365917 CTGGACATAAAAATAAAAAATGG - Intergenic
1173876756 20:46377469-46377491 CTAGAGAAACAGCTAGAAAAAGG - Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174100018 20:48120044-48120066 CTGGACACACAGACAGGGAGGGG - Intergenic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174152967 20:48498922-48498944 CTGGACACACAGACAGGGAGGGG - Intergenic
1175248656 20:57596249-57596271 AAGGTCACACAGCTAGAAAATGG + Intergenic
1175517959 20:59580860-59580882 CTAGACACACAGAAGCAAAAGGG + Intronic
1175666361 20:60863653-60863675 ATGGACAGACAGATAAATAAAGG + Intergenic
1176787974 21:13281874-13281896 CTGGACACAGAGAAAGAGATGGG + Intergenic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1176929613 21:14792436-14792458 CTTGAGACAGAGAGAGAAAAAGG - Intergenic
1177733236 21:25056407-25056429 CAGGACACAAAGATACAAAGTGG + Intergenic
1177763663 21:25432469-25432491 ATGGACAAACATATAGAAATGGG + Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178365942 21:31988848-31988870 CTGGAAACCGAGAAAGAAAAAGG - Intronic
1179126206 21:38592950-38592972 CCTGACACACACATAAAAAATGG - Intronic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1179501353 21:41811078-41811100 CTGAAAACACAGACAGAAAGTGG + Intronic
1181759103 22:25045490-25045512 CTAGACACAGACATAGATAAAGG + Intronic
1182660863 22:31924236-31924258 CGGGTCACACAGATAAAAAGTGG - Intergenic
1182996249 22:34815535-34815557 GTGGTCACACAGCTAGAAAGTGG + Intergenic
1183198414 22:36369123-36369145 CAGGACACACAGCTAGTCAATGG + Intronic
1183721096 22:39561848-39561870 CTTGAAAACCAGATAGAAAATGG - Intergenic
949601980 3:5610157-5610179 TTGGATACCCAGAGAGAAAAAGG + Intergenic
949809008 3:7985858-7985880 CTGTACACACAGCTAGTAGAGGG - Intergenic
949977146 3:9471324-9471346 GTGGTCACACAGCTAGTAAATGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951329442 3:21348287-21348309 AAGGACAGTCAGATAGAAAATGG + Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951545841 3:23824285-23824307 CAGGACACAGAGACAGAGAAGGG - Intronic
951547113 3:23837902-23837924 GTGGACAAGCAGAAAGAAAAGGG - Intronic
952203948 3:31160435-31160457 GTGGCCACAGAGGTAGAAAATGG - Intergenic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
952407867 3:33020892-33020914 CTACATACACAGAGAGAAAAAGG + Intronic
953390370 3:42530402-42530424 ATGGACACATGGATAAAAAATGG + Intronic
953708041 3:45245893-45245915 CCAGTCACACAGATAGAAAGAGG + Intergenic
955511015 3:59680281-59680303 CAGGACAAAAACATAGAAAAGGG + Intergenic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
956277634 3:67520329-67520351 CTGGATACCCAGAAAGAAAAAGG + Intronic
956334001 3:68143300-68143322 CTGGCCACACATACAAAAAATGG + Intronic
956870434 3:73411792-73411814 CCGGACACTCATATATAAAAAGG - Intronic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957021046 3:75126469-75126491 CAGGAAACACAGGTAGAGAATGG + Intergenic
957276460 3:78096737-78096759 GTGGACACTCAGATAACAAAAGG + Intergenic
957299414 3:78371946-78371968 ATGGCCACACAGCTAGAAAGTGG + Intergenic
957621636 3:82600902-82600924 GTTGAAACACAGATAGAAGAGGG - Intergenic
957632423 3:82734210-82734232 CTGGACACACATAGAAAAATAGG - Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958027894 3:88070847-88070869 TAAGACACACAGCTAGAAAAGGG + Intronic
958660600 3:97061844-97061866 CTGGAAATACAGACATAAAAAGG + Intronic
958784385 3:98581672-98581694 CTGGACAGGCAGAAATAAAAGGG + Intronic
959258273 3:104042497-104042519 CTGGAAACCCAGATAGGAATTGG - Intergenic
959381657 3:105648351-105648373 CTGGACACACAGAGAAACACAGG + Intergenic
959552903 3:107683791-107683813 ATAGACACATAGATAGAAACTGG - Intronic
962014772 3:131428547-131428569 TTGGACACACAGAGAGACAGTGG + Intergenic
962829611 3:139128554-139128576 CTGGGCACACAGAGACAAATAGG + Intronic
962939573 3:140113536-140113558 GTTGACACACAGTTAGAAAGGGG - Intronic
963047689 3:141115103-141115125 CTGGACACTCAGACACTAAATGG + Intronic
964447061 3:156770616-156770638 CAGGACACACAGCCAGAAAGTGG + Intergenic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964832429 3:160899158-160899180 CAGATCACACAGGTAGAAAATGG + Intronic
964965289 3:162484420-162484442 CTGATCACACAGAAATAAAATGG - Intergenic
965212457 3:165810406-165810428 CTGCACACACAGGAAGGAAATGG - Intronic
966674535 3:182571282-182571304 TTGGTCACACAGCTAGTAAATGG - Intergenic
967385859 3:188910228-188910250 CTGATCAAACAGAAAGAAAATGG + Intergenic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969723161 4:8904464-8904486 CAGGAGAGACAGAGAGAAAAGGG + Intergenic
970052058 4:11925569-11925591 AAGGTCACACAGATAGAAGATGG + Intergenic
970069612 4:12142707-12142729 CTGGACACACAGGGAAAAAATGG + Intergenic
970115449 4:12689689-12689711 CTGGACAGGGAGATAGAAAAGGG + Intergenic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970619293 4:17800756-17800778 ATACACACACAGAGAGAAAAAGG + Exonic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971477202 4:27083644-27083666 GGAGACACACAGAGAGAAAAAGG - Intergenic
971541428 4:27821800-27821822 CTTGACAGCCAGATAGAGAAAGG - Intergenic
972066369 4:34950884-34950906 ATTGATACACAGATATAAAAAGG - Intergenic
973802165 4:54489452-54489474 TTGGACTCTCAGATACAAAATGG + Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975558073 4:75683772-75683794 CTAGATACCCAGCTAGAAAAAGG - Intronic
975574360 4:75848178-75848200 TTGGACCCAGAGTTAGAAAAGGG - Intergenic
975650195 4:76585386-76585408 CAGCACACACAGAAAGAAAATGG - Intronic
976368351 4:84257416-84257438 CTTTAGACAGAGATAGAAAAGGG + Intergenic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
977548864 4:98418713-98418735 CTGGACAGACATGTAGAAGATGG + Exonic
978907176 4:114019925-114019947 CTTAACACATAAATAGAAAAAGG + Intergenic
979184109 4:117766520-117766542 CTGTATTCACAGACAGAAAAAGG - Intergenic
979455962 4:120926235-120926257 CTAGAGACACAGAGAGGAAATGG - Intergenic
979568948 4:122193068-122193090 CTGGACACAGAGGTACACAAGGG - Intronic
979762287 4:124421143-124421165 CTGGGCACACACTTAGGAAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981400696 4:144310597-144310619 ATGGACACAAAGAAAGAAAGGGG - Intergenic
981898549 4:149834488-149834510 AAGGTCACACAGATAGACAAGGG - Intergenic
982306638 4:153939112-153939134 CTGGGGACACAGATATAAACAGG + Intergenic
983039872 4:162913015-162913037 CTCCACACATAGTTAGAAAATGG - Intergenic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
985966212 5:3340511-3340533 CTGAACAGACACAGAGAAAAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
987729415 5:21749213-21749235 GTGAACACACAGAGAGAAGACGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987982796 5:25109328-25109350 ATGTACTCACATATAGAAAAAGG + Intergenic
988957938 5:36337559-36337581 CTGGACACACAGGAAGCAAAGGG + Intergenic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
989436604 5:41420737-41420759 CATGAAACACAGATACAAAATGG + Intronic
990829696 5:59942481-59942503 CTGGACACAGTGAGAGAATATGG + Intronic
991174099 5:63666137-63666159 ATGCACACACACATACAAAACGG + Intergenic
991364929 5:65858553-65858575 CTGGCCACTCAGAGAGAAAGAGG - Intronic
991462858 5:66877651-66877673 GTGCACACACTGAAAGAAAATGG - Intronic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
993205608 5:84874463-84874485 AGGAACAGACAGATAGAAAAGGG + Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
995516722 5:112961656-112961678 TTGAACACCCAGACAGAAAATGG + Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
996211550 5:120817550-120817572 CTCAACACATGGATAGAAAAGGG - Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
998376296 5:141692950-141692972 AAGGTCACACAGCTAGAAAATGG - Intergenic
999300542 5:150487411-150487433 AAGGTCACACAGATAGAAAGTGG + Intronic
999345390 5:150814321-150814343 CTGGACACACAAAAAGAAAATGG + Intergenic
1001277986 5:170364813-170364835 CTTGATACACACATAGATAATGG + Intronic
1001447473 5:171796995-171797017 TAGGACACACAGACAGGAAAGGG - Intergenic
1001759737 5:174197462-174197484 CTGGACACAGAGACAGACAGAGG + Intronic
1002075263 5:176704754-176704776 CTGGCCACACAGATAGAAGCAGG + Intergenic
1002661698 5:180795576-180795598 CTGCACACATAGAGAGCAAATGG + Intronic
1003635519 6:7828349-7828371 CTGAACACACAAACAGAACAGGG - Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1004001794 6:11602893-11602915 CGGGAAACACAGTTTGAAAAAGG - Intergenic
1004201996 6:13557070-13557092 CTAGCCACAGAGCTAGAAAATGG + Intergenic
1005120152 6:22380368-22380390 CTGGTCACACAGCTAAACAAGGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1008622143 6:53281038-53281060 CTGGAAACACTTAAAGAAAAAGG + Intronic
1010082609 6:71881714-71881736 GTGGAGACACAGGCAGAAAATGG - Intergenic
1011310615 6:85975813-85975835 CTGGACAAAAAGAAAGAAAGGGG - Intergenic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012038488 6:94173341-94173363 CTGGACACACAGCCATAAAAAGG + Intergenic
1012132567 6:95515775-95515797 TTGGACACACAAATATAGAAAGG + Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1013010320 6:106114690-106114712 CTGAACACTCAAGTAGAAAACGG - Intergenic
1013823315 6:114181230-114181252 CGGGTCACACAGATAGAAAGAGG - Intronic
1014476835 6:121883856-121883878 CAGAACACATATATAGAAAATGG - Intergenic
1014497297 6:122141455-122141477 AAGGACACACAGATAGAAAAAGG - Intergenic
1014519290 6:122420533-122420555 CTGGATTCACATATACAAAATGG - Intronic
1015484621 6:133754586-133754608 TTGGACACACAGAAAGCACAAGG - Intergenic
1016943453 6:149504253-149504275 CATGAAACACAGAGAGAAAAAGG + Intergenic
1017573118 6:155769753-155769775 CAGAACACACAGATATAAACAGG - Intergenic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1020360029 7:7318278-7318300 ATGGAGACACAGATAGGATAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1022221847 7:28321582-28321604 CTGGACACAAACACAGCAAAGGG - Intronic
1022267369 7:28770524-28770546 GTGGACTAACAGATAAAAAATGG - Intronic
1022945893 7:35283120-35283142 CAGGCCACACAGATACATAAAGG - Intergenic
1023269809 7:38450334-38450356 CTGGACACAAAGATAGACTCTGG + Intronic
1023512272 7:40966253-40966275 CAGGACACAGAGATAGTGAAAGG + Intergenic
1023613920 7:41999376-41999398 CTGTCCACAAAGACAGAAAAAGG + Intronic
1025234122 7:57222382-57222404 CTGGACACACAGACAGGGAGGGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1028796988 7:94914026-94914048 AAAGAAACACAGATAGAAAATGG - Intronic
1029179150 7:98687317-98687339 TTGGACACAAAGCTGGAAAATGG + Intergenic
1030175194 7:106645482-106645504 CTGCACAAAAAGACAGAAAAAGG + Intergenic
1030268441 7:107645246-107645268 AAGGTCACTCAGATAGAAAATGG + Intergenic
1030280780 7:107772905-107772927 CTGGATACAAAATTAGAAAATGG - Intronic
1031756640 7:125652109-125652131 CTGGACACAGAGATAGTAATGGG - Intergenic
1032064711 7:128758501-128758523 CAGGCCAAACAGCTAGAAAATGG + Intronic
1032070173 7:128800091-128800113 ATGGACAAACATATAGAAAAAGG - Intronic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034625247 7:152487395-152487417 CTGGACAGGGAGAGAGAAAAAGG - Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037776997 8:21842105-21842127 CTGGACATACAGAGATAAGAAGG - Intergenic
1037968198 8:23150033-23150055 CTGGAAACACATAGAGATAAGGG + Intronic
1038177538 8:25194744-25194766 CTGGACAGACAGCAAGAAACTGG - Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1039216317 8:35275665-35275687 CAGGTCACACAGAGAGTAAATGG - Intronic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040933864 8:52763619-52763641 CTGGACACACATAGAGCAAGAGG + Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041938313 8:63359067-63359089 GAGGACACACAGCTAGAAAATGG - Intergenic
1041970349 8:63734113-63734135 CTGGACACGCAGATTCTAAAGGG + Intergenic
1042007023 8:64192621-64192643 CTTGAGAAAGAGATAGAAAAAGG + Intergenic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1042553184 8:70012369-70012391 CTGGAGACAAAGATAAGAAATGG - Intergenic
1044174145 8:89096348-89096370 CTTTAGACAGAGATAGAAAAGGG - Intergenic
1044839393 8:96325026-96325048 CTAGCCACACAGATAGATGACGG + Intronic
1045378231 8:101597323-101597345 CTGGAGCCACAGTTAGAAATAGG + Intronic
1045862534 8:106829279-106829301 CTGGGCACACAGAGATGAAAAGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046951391 8:120023108-120023130 GTGGACACACAGTGAGAAACCGG - Intronic
1047116665 8:121849791-121849813 ATGGAAACAGAGATAGAAAGAGG - Intergenic
1047618941 8:126586789-126586811 ATGGTCACACAGAAAGTAAAGGG - Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047759128 8:127941066-127941088 CTGGACAGCCAGCAAGAAAACGG - Intergenic
1048498686 8:134956738-134956760 CTTGACACAGAGAGAGAAAAGGG + Intergenic
1048578556 8:135711901-135711923 CTAGAAACACCTATAGAAAAAGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050136828 9:2474273-2474295 CTGGACCCAAAGCTAGAAGAAGG + Intergenic
1050361812 9:4837616-4837638 CTGCACACCCAGAGAGAACAAGG - Intronic
1050758259 9:9034698-9034720 CTGGACACAGAGCTAGTAAATGG - Intronic
1051195947 9:14563119-14563141 CTGAAAACACAGGTAGAAATGGG + Intergenic
1052361477 9:27565281-27565303 CTGGGCAAACAGAAAAAAAAAGG + Intronic
1052374190 9:27699155-27699177 ATGGACACAGAGTTAGAGAAAGG + Intergenic
1052666426 9:31500487-31500509 CTGTACACACACATACACAATGG + Intergenic
1053362237 9:37496847-37496869 CTGGACTCACAGAGATAAAAAGG - Intronic
1054764891 9:69035365-69035387 CTGGTCACACAGCTAGGAAGTGG + Exonic
1055068769 9:72145975-72145997 ATGGATACACAGAAAGAAAGAGG + Intronic
1056137982 9:83647852-83647874 GTGAACACACAGAGAGATAAGGG + Intergenic
1057443446 9:95098009-95098031 CTGGAAACAGAGGAAGAAAAAGG + Intergenic
1057876124 9:98755766-98755788 GTGGACACAGAGATAGTCAAGGG + Intronic
1059433174 9:114261806-114261828 ATGGTCACACAGCTAGGAAATGG - Intronic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1060062914 9:120476778-120476800 GTGGACACAGAGCTAGAAAGTGG + Intronic
1060088264 9:120720868-120720890 CTGAACACCCAGGGAGAAAAGGG - Intergenic
1060130631 9:121094362-121094384 CCTGAGACACAGAGAGAAAAAGG + Intronic
1060556525 9:124510776-124510798 CAGGTCACACAGCTAGAAAGTGG - Intergenic
1061326092 9:129865626-129865648 CAGGCCACACAGCTAGTAAATGG + Intronic
1061749022 9:132762617-132762639 CTGGATAGCCACATAGAAAACGG + Intronic
1185831497 X:3307349-3307371 ATAGATACACAGATAGATAAAGG - Intergenic
1186215312 X:7293742-7293764 CTGGAAACTCAAATAGAAAGTGG - Intronic
1186257631 X:7739950-7739972 CTGGTCACACAGCTAGAAAATGG + Intergenic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1192048018 X:67696913-67696935 CAGGTCACACAGCTAGATAATGG - Intronic
1192167923 X:68837580-68837602 CTAAGCACACAGAAAGAAAATGG - Intronic
1193274980 X:79575515-79575537 AAGGTCACACAGGTAGAAAATGG + Intergenic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1193960447 X:87918511-87918533 CTGGACACAGGGATAGACAATGG + Intergenic
1194413352 X:93580908-93580930 CAGAACACACATAGAGAAAACGG + Intergenic
1196462103 X:115942326-115942348 CTGGATGCACAGAGAGAAATGGG + Intergenic
1197652504 X:129081107-129081129 ATGGTCACACAGCTAGTAAATGG + Intergenic
1197936775 X:131747655-131747677 ATGGACATACAAAAAGAAAAGGG + Intergenic
1198101176 X:133423068-133423090 AAGGACACACAGACAGTAAATGG - Intergenic
1198665631 X:139019159-139019181 ATGGATACACAGGTAGAAAGTGG + Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199819534 X:151430982-151431004 GTGAACACACAGGTAGAAGATGG + Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1201797729 Y:17918038-17918060 CTGGACAAAAAGATAGAATTTGG - Intergenic
1201803824 Y:17987919-17987941 CTGGACAAAAAGATAGAATTTGG + Intergenic
1202359066 Y:24086776-24086798 CTGGACAAAAAGATAGAATTTGG - Intergenic
1202511712 Y:25583338-25583360 CTGGACAAAAAGATAGAATTTGG + Intergenic