ID: 1164016574

View in Genome Browser
Species Human (GRCh38)
Location 19:21260177-21260199
Sequence TCCCAGACGGGGCAGCAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5660
Summary {0: 1, 1: 2, 2: 82, 3: 955, 4: 4620}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164016568_1164016574 -1 Left 1164016568 19:21260155-21260177 CCGGGCAGAGGCATTCCTCTCAT 0: 1
1: 4
2: 138
3: 1252
4: 4531
Right 1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG 0: 1
1: 2
2: 82
3: 955
4: 4620
1164016565_1164016574 16 Left 1164016565 19:21260138-21260160 CCCAGACAGGGTGGCAGCCGGGC 0: 16
1: 337
2: 2233
3: 4053
4: 4002
Right 1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG 0: 1
1: 2
2: 82
3: 955
4: 4620
1164016562_1164016574 24 Left 1164016562 19:21260130-21260152 CCTCACTTCCCAGACAGGGTGGC 0: 158
1: 2253
2: 3337
3: 6681
4: 12210
Right 1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG 0: 1
1: 2
2: 82
3: 955
4: 4620
1164016566_1164016574 15 Left 1164016566 19:21260139-21260161 CCAGACAGGGTGGCAGCCGGGCA 0: 12
1: 252
2: 1782
3: 3467
4: 3225
Right 1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG 0: 1
1: 2
2: 82
3: 955
4: 4620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164016574 Original CRISPR TCCCAGACGGGGCAGCAACC GGG Intronic
Too many off-targets to display for this crispr