ID: 1164017081

View in Genome Browser
Species Human (GRCh38)
Location 19:21262678-21262700
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 2, 1: 10, 2: 13, 3: 30, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164017081_1164017084 -5 Left 1164017081 19:21262678-21262700 CCTGCTCTGACCACTCTGGAGGC 0: 2
1: 10
2: 13
3: 30
4: 231
Right 1164017084 19:21262696-21262718 GAGGCTGGTCAGTCTACACACGG 0: 2
1: 4
2: 15
3: 32
4: 136
1164017081_1164017085 8 Left 1164017081 19:21262678-21262700 CCTGCTCTGACCACTCTGGAGGC 0: 2
1: 10
2: 13
3: 30
4: 231
Right 1164017085 19:21262709-21262731 CTACACACGGCTGAAGCTTGAGG 0: 3
1: 8
2: 26
3: 51
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164017081 Original CRISPR GCCTCCAGAGTGGTCAGAGC AGG (reversed) Intronic
900116880 1:1032865-1032887 GCCTCCAGGGTGGTCGGGCCTGG + Intronic
900394286 1:2446779-2446801 GCCTGCAGAGGGGTCAGAGCCGG + Intronic
903320297 1:22539067-22539089 GGCTCCTGAGTGGTCAGATGAGG - Intergenic
903794540 1:25918881-25918903 GGCACCAGAGGGGACAGAGCAGG + Intergenic
904710213 1:32424674-32424696 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
904914335 1:33959153-33959175 GCATCCATAGTCTTCAGAGCAGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905536806 1:38728770-38728792 GCCTCATGAGTGGGCAGGGCAGG - Intergenic
906737081 1:48140733-48140755 GCCTCCAGAGTAGACAGAGTAGG + Intergenic
908033497 1:60027289-60027311 GGCCCCAGGGTGGTTAGAGCAGG - Intronic
909498868 1:76310940-76310962 GAAACCAGAGTTGTCAGAGCAGG - Intronic
909808853 1:79905957-79905979 GCCTCCAGACTGGTGATAGGAGG + Intergenic
910592317 1:88939457-88939479 GCCTCCAGAGGGGCCAGAAGAGG - Intronic
913538378 1:119795748-119795770 GCATCCATAGTGCTCAGCGCAGG + Intronic
916036853 1:160929835-160929857 GCCTTCAGAGAGGTCTGAGTAGG - Intergenic
919630531 1:199956236-199956258 GGCCCCAGTGTGGACAGAGCTGG - Intergenic
919732454 1:200921947-200921969 CTCTGCAGAGAGGTCAGAGCAGG - Intergenic
920422854 1:205847248-205847270 CCCTCCAAAGTTGTCAGAGGTGG - Intronic
920423602 1:205854489-205854511 CCCTCCAAAGTTGTCAGAGGTGG + Intergenic
921866771 1:220094508-220094530 GCCTCCAGAGAGGCCCGATCCGG + Intronic
922481147 1:225940820-225940842 ACCTCCAGAGTGGGCACAACCGG + Intronic
923523795 1:234757155-234757177 GCGTCGAGAGCTGTCAGAGCGGG + Intergenic
1065886315 10:30080674-30080696 GCCTGCAGAGTGGTGAGATTGGG - Intronic
1067542558 10:47166379-47166401 GCCTCCACAGGGCTCAGGGCAGG - Intergenic
1067809916 10:49418274-49418296 GCCTCCTGAGGGGACAGAGTGGG + Intergenic
1069609386 10:69762540-69762562 GTCACCAGAGTGGTCAGGGAGGG - Intergenic
1070746912 10:78939272-78939294 GTCCCCAGAGAGGTCATAGCTGG - Intergenic
1070804502 10:79263186-79263208 GTTTCCAGAGTGGTCACAGCTGG + Intronic
1070922220 10:80195140-80195162 GCTTCCAGAGTGGTTTGAACAGG - Intronic
1072745725 10:97937895-97937917 GCCTCCAGAGGGTTCCCAGCTGG + Intronic
1073339138 10:102731840-102731862 CCCTCCTTAGTGGTCAGAGTAGG + Intronic
1074892093 10:117744203-117744225 GCTTCCAGAGTGGTCAGAGAGGG + Intergenic
1075258115 10:120941028-120941050 GCGTACAGAGTGTTCAGTGCTGG - Intergenic
1076260282 10:129059620-129059642 GGCTCCAGGATGGGCAGAGCAGG + Intergenic
1077474472 11:2779828-2779850 GCCTGCAGAGGGGCCAGCGCTGG + Intronic
1079075836 11:17385060-17385082 GCCTCCAGGGTGGTCTTAGAAGG - Intergenic
1079091870 11:17486346-17486368 GCCTGCAGAGTAGTCTGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083479418 11:62934061-62934083 GACTGCAGAGTGGCCAGAGTGGG - Intergenic
1083852222 11:65375072-65375094 ACCTCGAGAAGGGTCAGAGCAGG + Intergenic
1083920157 11:65778155-65778177 GCCTCCAGAGGGGGCCGGGCTGG - Exonic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084506211 11:69570029-69570051 GCCGCCAGATGGGTCAGAGGAGG - Intergenic
1084561464 11:69907872-69907894 GCCTCCATGGAGGCCAGAGCAGG + Intergenic
1085297853 11:75441088-75441110 GCTTGCCGAGTGGTCAGGGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085728408 11:78975279-78975301 GCCTCCAGAGGGGTGTGAGATGG + Intronic
1086607161 11:88709596-88709618 TCATCCTGAGGGGTCAGAGCAGG + Intronic
1089657697 11:119963563-119963585 GCCTTCAGAGTGGAGAGAGGTGG + Intergenic
1089704632 11:120269010-120269032 TCCTCCAGGGTGGTGATAGCTGG - Intronic
1090941619 11:131392668-131392690 GCGTCCAGACTGGGGAGAGCAGG - Intronic
1092786336 12:12030369-12030391 GCCTCCAGTGGGGTCAGACTTGG - Intergenic
1096339859 12:50788601-50788623 GCCTCCTGAGTAGCTAGAGCTGG + Intronic
1096629430 12:52916301-52916323 GCCTGCAGTGTGGTAGGAGCAGG + Intronic
1096805907 12:54141025-54141047 CCCTCCACAGAGGCCAGAGCAGG + Intergenic
1097269831 12:57767159-57767181 TCCTCCTGAGTGGTCTGTGCTGG + Exonic
1101591979 12:106132856-106132878 TCCTCTAGAGGGGTCTGAGCTGG - Intronic
1101761763 12:107664511-107664533 GCCTCCAGAGTAGCCACAGGTGG + Intergenic
1102001638 12:109561252-109561274 TGCTCCAGAGTGGGCAGGGCTGG + Intronic
1102240712 12:111322847-111322869 GGCTCCATGGTGCTCAGAGCAGG + Intronic
1102706513 12:114885491-114885513 GCCTCCAGAGTAGCTAGACCAGG + Intergenic
1103414865 12:120737213-120737235 GTCTCCAGAGAGATCAGGGCTGG - Intronic
1103489766 12:121308083-121308105 CTCTCCAGGGTGGTCAGTGCAGG - Intergenic
1105543962 13:21338594-21338616 GTATTCAGAGTGGTCAGAGCAGG + Intergenic
1111549039 13:89783677-89783699 GCCTCCAGCATGGTGAGAGTGGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1113726014 13:112602431-112602453 GCCACCACCGTGGTCAGAGGAGG + Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118633800 14:67729258-67729280 GCCGCCAGAGCAGGCAGAGCAGG - Exonic
1119197396 14:72727173-72727195 GCCCCAAGACAGGTCAGAGCTGG - Intronic
1119842052 14:77800473-77800495 GGCACCCGAGTGGGCAGAGCTGG + Intronic
1121180193 14:91923097-91923119 GCATCCTGAGTGGTCAAGGCTGG + Intronic
1121429038 14:93873970-93873992 GCCTCAGGAGGGGGCAGAGCTGG - Intergenic
1122135215 14:99628845-99628867 CCCTTCACAGTGGGCAGAGCAGG - Intergenic
1122691747 14:103534942-103534964 GCCTCCTGGGTGGCCAGAGTGGG + Exonic
1122768623 14:104087095-104087117 GCCTCCAGAGGGGTCTGCACCGG - Intronic
1122813300 14:104299518-104299540 GCGTCCAGGGTGGTCACAGAGGG + Intergenic
1122911122 14:104827984-104828006 GACACCAGAGTGCTCAGGGCAGG + Intergenic
1127339103 15:58022145-58022167 GCCCCCACAGTGGTGAGAGGAGG - Intronic
1128387070 15:67157466-67157488 GCCTCCTGAGTTCTCTGAGCTGG + Intronic
1128508796 15:68300828-68300850 GCCTGCAGTGTGGTCACAGGTGG + Intronic
1128739814 15:70075922-70075944 GCCTCCAGACTGGCCGGAGAAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129061871 15:72866955-72866977 TCCTCCAGAGTGGCCAGCACTGG - Intergenic
1129671594 15:77610821-77610843 GCCTCAAGGCTGGTAAGAGCAGG - Intergenic
1129680981 15:77658165-77658187 GACTCCAGGGTGGGCAGGGCAGG - Intronic
1129776060 15:78237213-78237235 GGCCCCAGAGTGCTCAGCGCGGG + Intronic
1129851567 15:78796772-78796794 GCCTCCAGTGTACCCAGAGCTGG - Exonic
1130871483 15:87975610-87975632 GCCTCTAGGGAAGTCAGAGCTGG - Intronic
1132463631 16:67726-67748 GCCTCCACAGTGCTCAGGACTGG + Intronic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1136060900 16:27725809-27725831 GCCTCCAGCCTGGTCACACCAGG + Intronic
1136247744 16:28985165-28985187 GCTCCCAGGGTGGTCAGACCAGG - Intronic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1137639993 16:50020539-50020561 GCCACCAGAGGGTTCTGAGCAGG + Intergenic
1138595874 16:58028654-58028676 GCCTCCAGTAGGGTCACAGCTGG + Intronic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1142011132 16:87714711-87714733 GCCTGCAGTGTGCTCAGGGCTGG + Intronic
1142352386 16:89586234-89586256 GGCTCCTGAGGGGTCATAGCAGG + Intronic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1143100570 17:4502522-4502544 GCCACTAGAGTGGACAGTGCAGG + Intronic
1145233869 17:21194923-21194945 GCCTCCAGAGTTTTCACATCTGG - Intergenic
1146223836 17:31049311-31049333 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
1146550318 17:33775176-33775198 GACTCCATGATGGTCAGAGCTGG + Intronic
1147147491 17:38493655-38493677 GCCTCCAGGCTAGACAGAGCTGG - Intronic
1147453436 17:40520128-40520150 GCATCCAAACTGGTCAGAACCGG + Intergenic
1147741680 17:42673903-42673925 GCCTCCAGAGTGCACTGAGGGGG + Intronic
1148119278 17:45198061-45198083 GCCTCCCCAGAGGTCAGATCAGG + Intergenic
1148561740 17:48610407-48610429 GCGTCCAGAGTGCTCCCAGCCGG - Intronic
1148713197 17:49696780-49696802 GCCCCCAGCGTGTTCAGACCAGG - Intergenic
1149620815 17:58043696-58043718 CCCCTCAGAATGGTCAGAGCAGG - Intergenic
1152121288 17:78420253-78420275 CCCTCCTGGGTGGGCAGAGCAGG - Intronic
1152564305 17:81093281-81093303 GCCTCCAGAGCTGGCTGAGCAGG - Intronic
1153330276 18:3866763-3866785 GCCACCAGAGTGGAAAGGGCAGG + Intronic
1153626101 18:7023624-7023646 GCATCCGGAGTGGTCAGGGGTGG - Intronic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1155526576 18:26721850-26721872 GCCTCCAGAGTGGTATGAGCAGG + Intergenic
1156622939 18:38874239-38874261 GCCCCCTGAGTGGACAGAGCTGG - Intergenic
1157329265 18:46691629-46691651 ACTTCCAGAGAGGTAAGAGCTGG - Intronic
1158315827 18:56210421-56210443 GAGTCCAGAGTGGTGAGAACTGG - Intergenic
1159001908 18:62981932-62981954 ACTTCCAGAGTGGTCAGAACTGG + Intergenic
1160165566 18:76508073-76508095 GCTTCCACAGTGCTCAGAACGGG - Intergenic
1161535347 19:4816035-4816057 GCTTTCAGGGTGGTCAGAACTGG - Exonic
1161700305 19:5790885-5790907 GCCTGCAGGGTGGTCAGCGGAGG - Intronic
1161740374 19:6017701-6017723 CCCTTCAGAGTGGGCAGTGCTGG + Intronic
1162773697 19:12965822-12965844 GTCTCCAGGGTGGTCAGGGAAGG - Intronic
1163768503 19:19176845-19176867 GCATTCACAGTGGTCAGTGCAGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1165407201 19:35638137-35638159 GAGCCCAGAGTGGTCAGGGCAGG + Intergenic
1165792421 19:38500220-38500242 ACACCCAGAGTGGTCAGGGCTGG + Intronic
1165934809 19:39382914-39382936 GTGTCCAGAGTAGTCACAGCAGG + Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168350103 19:55670770-55670792 GCCTCCAGGGTGGTCACGCCTGG + Intronic
1168568410 19:57443374-57443396 GCCTTCAGGGTGGACAAAGCTGG - Exonic
1168630718 19:57954149-57954171 GCCTCCAGCGTGGACAGACTGGG - Intergenic
1168651550 19:58095589-58095611 GCCTCCACCATGCTCAGAGCTGG - Intronic
926171746 2:10556992-10557014 GCCTCCAGGACGGTGAGAGCGGG + Intergenic
927190230 2:20512295-20512317 CCACCCCGAGTGGTCAGAGCCGG + Intergenic
927198778 2:20565752-20565774 GCCACCAGGCAGGTCAGAGCAGG + Intronic
927825229 2:26303986-26304008 TCCTCCGGTGTGGTCAGAGCAGG - Intergenic
932018664 2:68059913-68059935 GACTTCAGAGTGGTCATTGCTGG - Intronic
932434619 2:71695643-71695665 GCCTCCAGGCTGGTCAGAGAGGG + Intergenic
933060908 2:77735228-77735250 TCCTCAAGAGTGGCCAGAGTGGG + Intergenic
938271101 2:129972395-129972417 TCCTTCAGAGGGGTCACAGCTGG + Intergenic
939329879 2:140743844-140743866 GCCTCCCGAGTAGTTACAGCGGG - Intronic
939709835 2:145503720-145503742 CCATCCACAGTGGTCAGGGCTGG + Intergenic
948825099 2:240570213-240570235 GCCTGCAGAGTGGCCGGACCAGG + Intronic
1169327035 20:4684755-4684777 GCCTGCAGGGAGGACAGAGCTGG - Intergenic
1170651358 20:18245490-18245512 GGCTCCAGAAAGGACAGAGCTGG - Intergenic
1172893522 20:38283733-38283755 GGCTCCAGAGAGATCTGAGCTGG + Intronic
1173810171 20:45950594-45950616 GCCTGCAGAGAGGGCAGAGTTGG + Exonic
1174446475 20:50594471-50594493 GCCTTCAGGGTGGCCACAGCTGG - Intronic
1174783907 20:53414831-53414853 GGCTCCTGAGTGGGCAGACCTGG + Intronic
1175275820 20:57770029-57770051 GCCTGGAGAGTGGAGAGAGCAGG - Intergenic
1175466725 20:59194448-59194470 GCCCCCAGGCTGGCCAGAGCTGG + Exonic
1175861093 20:62150897-62150919 GCTTCCAGAATCGGCAGAGCTGG + Intronic
1175913384 20:62414939-62414961 ACCTCCAGAGTGGCCAGGCCTGG - Intronic
1176008848 20:62881062-62881084 GCCCCCAGCGGGGTCCGAGCAGG - Exonic
1176063655 20:63183095-63183117 GCCTCCCAAGTGTTCAGAGGTGG - Intergenic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1179146834 21:38775408-38775430 GCCTCCAGGGTTGTCACAGAAGG - Intergenic
1179280612 21:39930953-39930975 GCTTCCAGAGGGGTCAGCGTTGG - Intergenic
1179788582 21:43743113-43743135 GTCCCCATAGTGCTCAGAGCGGG - Intronic
1180226255 21:46394143-46394165 GCCGGGAGAGTGGTCAGGGCCGG - Intronic
1181535068 22:23537589-23537611 GGCTGCAGAGTGGAGAGAGCAGG + Intergenic
1181800946 22:25347380-25347402 TCCTCAAGCGTGGTCAGAGTGGG + Intergenic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1183540976 22:38429290-38429312 GTCTACAGAGGAGTCAGAGCTGG - Intronic
1184699809 22:46163078-46163100 GCCTGCAGAGGGGAAAGAGCGGG + Intronic
1184742962 22:46439722-46439744 GCCTGCAGGGTGCTCAGAACGGG - Intronic
1185374343 22:50475150-50475172 GGCCCCAGAGTGGTCAGCGATGG - Intergenic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
950040626 3:9917178-9917200 GCCTCCAGAGGGGGCGGAGGGGG - Exonic
952401889 3:32970797-32970819 GCTTCCAGTGTGGTCAGAGCAGG - Intergenic
952508936 3:34034914-34034936 GTCTGCAGAGTTGTGAGAGCTGG + Intergenic
952568564 3:34685637-34685659 GCCTCCAGTGTGGTCGGAGCAGG - Intergenic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
953606303 3:44415348-44415370 GCCTCCAGGGTGGGCACAGAGGG + Intergenic
957970319 3:87375206-87375228 TCCTCAAGTGTGGCCAGAGCGGG - Intergenic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961352152 3:126310971-126310993 GCCTCCAGAGTGGGCCGCGGTGG - Intergenic
962648789 3:137467046-137467068 GGCTCCAGAGTGCGTAGAGCAGG - Intergenic
963377278 3:144484303-144484325 GAATCCAGAGAGGTGAGAGCTGG - Intergenic
963771515 3:149391075-149391097 GCCTCCTCAGTGGTTAGAGATGG - Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
966366235 3:179190683-179190705 GCCTCCAGAGGAGACAGAGACGG - Intronic
967140385 3:186553002-186553024 GCCATTAGAGGGGTCAGAGCAGG + Intronic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
968481498 4:835040-835062 GCCTGCACAGGGGTCAGGGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
978958973 4:114652252-114652274 GTCACCAGAGTGGTCAGGGATGG + Intronic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979728279 4:123991172-123991194 GTCCCCAGAGTGGCCACAGCAGG - Intergenic
982630186 4:157821893-157821915 TCCTCTAGTGTGGCCAGAGCAGG - Intergenic
983442839 4:167809516-167809538 ACCTCCAGAGTTGTCAGGGCAGG + Intergenic
983448612 4:167883152-167883174 GTCTACAGAGTGGAGAGAGCAGG - Intergenic
986225747 5:5810722-5810744 GCTTCCAGAGTGGGCAAACCAGG - Intergenic
990665776 5:58069583-58069605 TCCTCCAGCGTGGCCAGAGTGGG + Intergenic
991505365 5:67318750-67318772 TCCTCAAGCGTGGCCAGAGCAGG - Intergenic
998483071 5:142479168-142479190 CCCACCAGTATGGTCAGAGCTGG + Intergenic
999687469 5:154115921-154115943 GCCTCCAGAGCCCTCAGAGTGGG + Intronic
1001254567 5:170173509-170173531 GCCTACAGAGTGGCCAGCGCTGG + Intergenic
1003408122 6:5839787-5839809 GTATTCAGAGTGGTCACAGCAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006676924 6:35771289-35771311 GTCTCCAGAGGGGACATAGCAGG - Intergenic
1008498287 6:52154627-52154649 GCATACAGGATGGTCAGAGCAGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1009494737 6:64332673-64332695 GCCTCCAGTGTGGATGGAGCAGG - Intronic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1018352347 6:162973206-162973228 GCCTCATGACTGGTCAGTGCTGG - Intronic
1019372240 7:668627-668649 GGATCCAGAGGGGTCAGAGATGG + Intronic
1019642342 7:2110768-2110790 GCCCCCAGTGCGGTCCGAGCAGG + Intronic
1021168793 7:17373056-17373078 TCATTCAGGGTGGTCAGAGCAGG - Intergenic
1023736823 7:43242751-43242773 GCCTGCAGATGGGGCAGAGCTGG + Intronic
1023843034 7:44107378-44107400 GCTCCCAAGGTGGTCAGAGCAGG + Intronic
1023871708 7:44266763-44266785 GCCTCCTGAGTGGCCAGCCCTGG + Intronic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1024748264 7:52431711-52431733 TCCTCAAGAGTGGCCAGAGTGGG + Intergenic
1025625976 7:63222136-63222158 GACTGCAGTGTGGTCAAAGCAGG + Intergenic
1025656139 7:63520985-63521007 GACTGCAGTGTGGTCAAAGCAGG - Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026919483 7:74144684-74144706 GCCTCCCGAGTAATCCGAGCCGG + Intergenic
1027201618 7:76067586-76067608 GCCACCAGAGTGGAGAGGGCTGG - Intergenic
1028058802 7:86282626-86282648 TCCTCAAGAGTGGCCAGAGAGGG + Intergenic
1029701239 7:102248297-102248319 GCCTCCAGGCTGGACGGAGCAGG + Intronic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034821185 7:154217809-154217831 CCCTCCTGGGTGGTCACAGCAGG - Intronic
1035081790 7:156222306-156222328 GCCTCCAGGATGGTGAGAGAAGG + Intergenic
1036463299 8:8973434-8973456 GCCTCCAGAGAGTTGTGAGCTGG + Intergenic
1038014014 8:23498037-23498059 GCCTCCAGACTGGAAAGATCAGG - Intergenic
1040300980 8:46187892-46187914 GCCTCCAGGGTTGTCACAGGTGG - Intergenic
1040329841 8:46380255-46380277 GCCTCCAGAGCTGTCTGAGACGG + Intergenic
1040378218 8:46847128-46847150 CTCTCCAGACTGGTTAGAGCTGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041038597 8:53821564-53821586 GCCTCCAGAGTAGTAGTAGCTGG - Intronic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1042207104 8:66340350-66340372 GCCTACAGAGTGGATTGAGCAGG + Intergenic
1045368969 8:101502277-101502299 CCCTCCAGAGGGGTCTGGGCTGG + Intronic
1048931146 8:139316271-139316293 GCCTGGAGTGGGGTCAGAGCAGG + Intergenic
1048986565 8:139738071-139738093 GCCTCCCTCGTGGTCAGAGTGGG - Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049107728 8:140624206-140624228 GGCTCCAGAGGGGGCAGAGCCGG - Intronic
1051189964 9:14501033-14501055 GCCTCCATTGTGCTCAGAGTGGG - Intergenic
1051391995 9:16575340-16575362 GCCTCCAGTGTAGTCACTGCTGG - Intronic
1053393326 9:37751765-37751787 TCCTCAAGCGTGGCCAGAGCGGG - Intronic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1060552552 9:124492474-124492496 GGCTCCAGAGAGCTCAGAGTCGG - Intronic
1060788015 9:126465655-126465677 GCCTCCAGATTGGTGGGGGCGGG + Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062562194 9:137146576-137146598 GGCTGCAGAGAGATCAGAGCTGG + Intronic
1062595968 9:137299415-137299437 ACCTCCAGCGTGCCCAGAGCTGG - Intergenic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1186452126 X:9682796-9682818 GCCTGCAGAGTGGTCTAACCAGG + Intronic
1186468735 X:9804765-9804787 GGCTCCAGACTGGGCAGTGCTGG - Intronic
1189129102 X:38479957-38479979 TGCTCCAGAGAGGGCAGAGCTGG - Intronic
1190343240 X:49313849-49313871 GCCTCTGGTGTGGTCAGAGCAGG - Intronic
1190447817 X:50547153-50547175 ACCTGCAGAGTGGTCAGAGGAGG + Intergenic
1190651274 X:52571132-52571154 GCCTCCAGTGTGGTCGGAGCAGG + Intergenic
1195368546 X:104150371-104150393 TCCTCCAGAGTGATCAGCACTGG - Intronic
1195395896 X:104410173-104410195 GCCACCAGAATAGTCAAAGCTGG + Intergenic
1195684663 X:107574801-107574823 GCCTCCTCATTGGTCAGAGAAGG + Intronic
1196482730 X:116168572-116168594 GCCTCCCGAGTGGTCACAATGGG - Intergenic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198975201 X:142328057-142328079 GATTCCAGAGTGGTGATAGCAGG + Intergenic
1200086789 X:153611058-153611080 CCCTCCAGATGGGGCAGAGCAGG - Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201378323 Y:13345312-13345334 GCCTCCGGTATGGTCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic