ID: 1164017330

View in Genome Browser
Species Human (GRCh38)
Location 19:21264674-21264696
Sequence TCCCAGATGGGGCAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164017330_1164017340 24 Left 1164017330 19:21264674-21264696 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1164017340 19:21264721-21264743 GCTGCCTTGTTTAGGAAGTGAGG 0: 1
1: 0
2: 3
3: 77
4: 842
1164017330_1164017338 16 Left 1164017330 19:21264674-21264696 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1164017338 19:21264713-21264735 GCCTGGCTGCTGCCTTGTTTAGG 0: 1
1: 0
2: 3
3: 31
4: 310
1164017330_1164017336 -1 Left 1164017330 19:21264674-21264696 CCCGGCTGCTGCCCCATCTGGGA 0: 6
1: 34
2: 291
3: 1900
4: 6357
Right 1164017336 19:21264696-21264718 AAGTGAGGAGAACCTCTGCCTGG 0: 1
1: 793
2: 5818
3: 10738
4: 8590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164017330 Original CRISPR TCCCAGATGGGGCAGCAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr