ID: 1164023222

View in Genome Browser
Species Human (GRCh38)
Location 19:21327585-21327607
Sequence TAAGGTGAGCAGAATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164023222_1164023228 2 Left 1164023222 19:21327585-21327607 CCCACCCCATTCTGCTCACCTTA 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1164023228 19:21327610-21327632 TGCTCAATAACCACCCTCTCAGG 0: 1
1: 7
2: 5
3: 24
4: 97
1164023222_1164023232 24 Left 1164023222 19:21327585-21327607 CCCACCCCATTCTGCTCACCTTA 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1164023232 19:21327632-21327654 GAGACATTACACTATGCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164023222 Original CRISPR TAAGGTGAGCAGAATGGGGT GGG (reversed) Intronic
902139706 1:14342673-14342695 GAAGGTGAGGAGAAAGAGGTTGG + Intergenic
902663567 1:17921952-17921974 CAAGGAGAACAGAAAGGGGTGGG - Intergenic
902981594 1:20127231-20127253 TAAGGTCAGCACCCTGGGGTAGG + Intergenic
905847706 1:41246558-41246580 TAATGGGAGTAGAGTGGGGTAGG + Intergenic
905861837 1:41357319-41357341 GATGGTGTGCAGAATGGGCTTGG + Intergenic
906255689 1:44348184-44348206 TAGGGAGGACAGAATGGGGTGGG - Intronic
906399480 1:45494592-45494614 TCTGGTGAGTAGAATGAGGTAGG - Intronic
909390849 1:75119807-75119829 TAAGGAGACCTGAATGGGGATGG + Intergenic
910678708 1:89841329-89841351 TGAGGTGAGGAGAAAAGGGTGGG + Intronic
911259083 1:95665562-95665584 TTAGGACAGCAGAATGGTGTTGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
913519872 1:119634757-119634779 TAAGGTCAGTATATTGGGGTTGG - Intronic
914719937 1:150281656-150281678 CACGGGGAACAGAATGGGGTAGG - Intergenic
915553606 1:156648926-156648948 TAAACTGATCAGACTGGGGTAGG - Intronic
915792123 1:158684001-158684023 TTAGGTGAATAGAAAGGGGTAGG + Intronic
917409016 1:174738470-174738492 TAGGGTCTGCAGAGTGGGGTGGG + Intronic
917677250 1:177331471-177331493 TAAGGTGGGCTGATTTGGGTAGG + Intergenic
918302954 1:183220496-183220518 TCAGATGAGCAGAATGGGTGTGG - Intronic
919691270 1:200530629-200530651 TTAGCTGAGCAGAATGGGAGTGG - Intergenic
920358321 1:205392757-205392779 AAAGGAGAGAAGAATGAGGTGGG + Intronic
922799426 1:228358192-228358214 TGAGGTGAGCAGATGGGGTTAGG + Intronic
923418002 1:233783900-233783922 TGAGATGAGCAGAATGTGATAGG + Intergenic
1063653130 10:7960327-7960349 TTAGATGAGCTGAATGTGGTAGG + Intronic
1064566426 10:16644086-16644108 TAAGGTGGGCAGAGGGTGGTGGG + Intronic
1064581727 10:16799688-16799710 TAAGGAGAGCAGAATGCTTTGGG - Intronic
1065123600 10:22551643-22551665 TATGGTTAGCCGAAAGGGGTGGG - Intronic
1067148016 10:43707602-43707624 TAAGGTGATCAGCATGGCCTGGG + Intergenic
1070020455 10:72580323-72580345 TTGGGTGAGTAGAGTGGGGTGGG - Intronic
1070461883 10:76678357-76678379 AAAGGTGAGCAGTCTGGAGTGGG + Intergenic
1070743258 10:78916449-78916471 TGAGGTCAGCAGAGGGGGGTTGG - Intergenic
1070773305 10:79095466-79095488 TTAGGTCAGGAGAATGGGGTTGG - Intronic
1072189966 10:93070886-93070908 AGAGGAGAGAAGAATGGGGTGGG + Intergenic
1072809484 10:98447641-98447663 TAAGGTGGGCTGGAAGGGGTGGG - Intergenic
1073542358 10:104324342-104324364 GCAGGTGAGCAGACTGGGGCCGG + Intronic
1073708251 10:106011137-106011159 TAAGCTGTGCAGTCTGGGGTTGG + Intergenic
1075568038 10:123518864-123518886 TAAGAGGAGCAGAAGGGGATGGG + Intergenic
1076054347 10:127359177-127359199 CAAGGTGAGCAGGAGTGGGTGGG - Intronic
1079516961 11:21281009-21281031 TAAGCTGTGCAGCCTGGGGTTGG - Intronic
1080525886 11:33117033-33117055 TAAAGTTAGCAGATGGGGGTTGG + Intronic
1081048091 11:38301418-38301440 TAAGGTGATAAAAATGAGGTAGG - Intergenic
1081067089 11:38557258-38557280 TAATGTGAGCAGAATGAGAAAGG - Intergenic
1084948236 11:72650562-72650584 TAAGGGGAGGAGATTGGGGAAGG - Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085700351 11:78740359-78740381 TGAGGTGAGGAGGGTGGGGTGGG - Intronic
1086558929 11:88144938-88144960 TTATGTGAGCAGAATGGAGCAGG + Intronic
1089586898 11:119515395-119515417 ACAGGTGAGCAACATGGGGTAGG + Intergenic
1089773160 11:120817592-120817614 AGAGGTGAGCAGAATGGAGAGGG - Intronic
1090206179 11:124885615-124885637 TAAGGTTAGTAAAATGGGGATGG + Intronic
1090374028 11:126276520-126276542 TGAGGTAAGCTGAGTGGGGTGGG + Exonic
1090436798 11:126693921-126693943 CAAGGTGGGCAGACAGGGGTGGG - Intronic
1092039913 12:5374912-5374934 AAATGTGCGCACAATGGGGTAGG - Intergenic
1093013999 12:14138148-14138170 CCAGGTGAGAAGTATGGGGTTGG - Intergenic
1094316010 12:29138277-29138299 TAAGCTGAGAAGATTGGGGAAGG + Intergenic
1094332385 12:29308568-29308590 TAAGGTCAGCTGAATGGCTTAGG + Intronic
1095850473 12:46798311-46798333 TAAGGTGAGGAGAGTGTGGACGG - Intronic
1096615419 12:52830213-52830235 GAAGGTGAGCCGAGTGGAGTGGG - Exonic
1098428079 12:70389093-70389115 TAAAGAGAGGAAAATGGGGTAGG - Intronic
1100786652 12:98085992-98086014 TAAAGTGAGGAAAATGGAGTAGG - Intergenic
1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG + Intergenic
1106046291 13:26145292-26145314 TCAGGTGATCGGAATGTGGTGGG + Intronic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1108886599 13:55192859-55192881 TAAAGTGAGCAGAGTGGAGAGGG - Intergenic
1109652557 13:65348754-65348776 TAAGGTTACCAGAATTGGTTAGG + Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1112153143 13:96786276-96786298 GAACTGGAGCAGAATGGGGTAGG - Intronic
1113365600 13:109672779-109672801 TATGGTCAGCAGAATGTGGAAGG - Intergenic
1114038300 14:18650312-18650334 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
1114120321 14:19664730-19664752 TAAGGTCAGCTGAATGGCTTAGG - Intergenic
1114559692 14:23580924-23580946 TAGGGTGAGGGGAGTGGGGTGGG - Intergenic
1114626342 14:24132498-24132520 AAAGGTGAGCAGGAAGGTGTGGG - Exonic
1114854173 14:26417623-26417645 TAATGGGAGCAGAATTGGTTTGG - Intergenic
1115127512 14:30014091-30014113 TAAGGAAAGCAGAATAGGGCAGG + Intronic
1117221948 14:53615324-53615346 TAAGGTGAACAGATTGAGGCAGG + Intergenic
1117288974 14:54314458-54314480 TCAGGTGAGCAGAAGCGGGAAGG - Intergenic
1119453575 14:74734594-74734616 TGAGGAGAGCACAATGTGGTGGG + Intronic
1119466247 14:74861152-74861174 TGAGGGCAGCAGGATGGGGTGGG - Intronic
1120106424 14:80500772-80500794 TGGGGTGAGGAGAAGGGGGTGGG - Intronic
1121128127 14:91421197-91421219 CAAGGGTAGCAGAATGGGGCAGG - Intergenic
1121390117 14:93566428-93566450 TAAGGTGTGCAGGCTGGGCTGGG + Intronic
1121454531 14:94029875-94029897 AAAGGTGAGAGGGATGGGGTGGG + Intronic
1122115494 14:99525419-99525441 TCAGGTGGGCAGGCTGGGGTGGG - Intronic
1122532961 14:102441819-102441841 TACTGTCAGCAGAATGGGGAAGG + Intronic
1124855225 15:33381189-33381211 TAAGATGAGCAGGAAGGCGTTGG - Intronic
1125592056 15:40860796-40860818 TAAGATGAGCAGATGGGTGTGGG + Intergenic
1127439083 15:58988065-58988087 TAAGGTGAGGGGAACGGGGGGGG + Exonic
1127846824 15:62877605-62877627 TAAGGTGATCAGAAGCAGGTGGG + Intergenic
1128687492 15:69697645-69697667 TATGGGGAGCAGAATGGAGCAGG - Intergenic
1128909008 15:71495182-71495204 TATGGTGAGAAAAACGGGGTTGG - Intronic
1131570758 15:93532906-93532928 TGAGGTGAGATGAATGGCGTAGG - Intergenic
1131862787 15:96672494-96672516 TAAGGAGAGCAGAAAGAGCTCGG - Intergenic
1132118962 15:99159995-99160017 TCAGGTCAGAATAATGGGGTAGG - Intronic
1132353693 15:101156202-101156224 TCAGGTGAGCAGCATGGAGGTGG + Intergenic
1132396637 15:101479651-101479673 ATAGGTGAGCAGAACGGTGTGGG + Intronic
1134602289 16:15542843-15542865 GCAGGTGAGCAGATTGGGGCTGG + Intronic
1134822609 16:17258908-17258930 GAAGGTGAGCAGAATGGGGCTGG + Intronic
1137038517 16:35588588-35588610 TCAGGTGAGAAAGATGGGGTGGG - Intergenic
1138142430 16:54580440-54580462 TGAGGTGGGGAGAGTGGGGTGGG - Intergenic
1139555789 16:67709194-67709216 TCAGGAGAGGAGACTGGGGTGGG + Intronic
1139672338 16:68500268-68500290 TAAAGTGAGAATAATGGGGCTGG + Intergenic
1140410747 16:74739080-74739102 ACAGGTGAGCAGAGTGGGGTGGG - Intronic
1141035543 16:80622391-80622413 TAGGGGGAGGAGAATAGGGTGGG - Intronic
1141835301 16:86534817-86534839 TAAGGGGTGCAGTAAGGGGTAGG + Intronic
1141934711 16:87229536-87229558 TAAGGCGTGAAGAATGGGCTCGG - Intronic
1142352229 16:89585782-89585804 GCAGGTGAGCAGGACGGGGTAGG + Exonic
1143631660 17:8143531-8143553 TAAGGATAGCTGGATGGGGTTGG + Exonic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1146480852 17:33203748-33203770 TAGGGTGAGCACACTGGAGTGGG + Intronic
1148203237 17:45763754-45763776 CAAGGAGAGCAGACAGGGGTAGG - Intergenic
1148915449 17:50973307-50973329 AAAGGAGAGGAGAATGGGATTGG + Intronic
1148983352 17:51598852-51598874 AAAGGGGAGCAGAATGAGTTTGG + Intergenic
1149211801 17:54312016-54312038 TAAGGTGAGAAGAGTAGAGTAGG - Intergenic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1151553217 17:74833957-74833979 AGAGCTGAGCAGGATGGGGTGGG - Intronic
1153014845 18:574130-574152 TAAGTGGAGCAGATAGGGGTTGG + Intergenic
1153514119 18:5889629-5889651 TTGGGTGAGCACAGTGGGGTGGG + Exonic
1156458259 18:37306802-37306824 TAAGGAGAGGAGAATGGGGAGGG + Intronic
1158341935 18:56475563-56475585 TAAGGTGAGGTGAATGATGTAGG - Intergenic
1160326465 18:77953697-77953719 CTAAGTGAGCAGAATGGTGTGGG + Intergenic
1161079662 19:2304346-2304368 TGGGGTTGGCAGAATGGGGTTGG + Intronic
1161302024 19:3547436-3547458 CAAGGTGAGCAGATTGGGGCGGG - Exonic
1162495774 19:11022663-11022685 TAAGGTGGGAAGAAGGGGGTGGG - Intronic
1162618598 19:11821630-11821652 TTCGGTGAGCAGGATGGGGGTGG + Intronic
1162627324 19:11895002-11895024 TTCGGTGAGCAGGATGGGGGTGG + Intronic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1164048773 19:21566273-21566295 TTAAGTGAGCAGGCTGGGGTGGG - Intergenic
1164095725 19:22008428-22008450 TTAAGTGAACAGGATGGGGTGGG - Intronic
1164101171 19:22055650-22055672 TTATGAGAGCAGGATGGGGTGGG + Intronic
1164123514 19:22288986-22289008 TTAAGTGAGCAGAATGGAGTGGG + Intronic
1164176630 19:22781283-22781305 TTAAGTGAGGAGAATGGGGTGGG - Intronic
1164198958 19:23001003-23001025 TTAAGTGAACAGGATGGGGTGGG - Intronic
1164226083 19:23247532-23247554 TTAAGTGAGCAGGATGGGGTGGG - Intronic
1164241429 19:23392913-23392935 TTAAGTGAGCAGGATGGGATGGG - Intronic
1164272397 19:23684714-23684736 TTAAGTGAGCAGGATGGGGTGGG - Intronic
1165946938 19:39449243-39449265 TGAGGTGAGCAGAGAGTGGTGGG + Intronic
1167229588 19:48273360-48273382 TCAGGTGAGCAGGCTGAGGTTGG - Intronic
1168070513 19:53947846-53947868 TAAGGGGGGCAGTATAGGGTAGG - Intergenic
925239585 2:2312167-2312189 TAAGCGGAACAGAATGGGGAGGG - Intronic
928371654 2:30744379-30744401 TAATGTCAGCAGAATCGCGTTGG - Intronic
929181373 2:39043774-39043796 TAAGGTCATCAGGGTGGGGTGGG - Intronic
934196961 2:89845429-89845451 GAAAGTTATCAGAATGGGGTTGG - Intergenic
938443574 2:131357327-131357349 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
938501370 2:131832724-131832746 TGAGCAGCGCAGAATGGGGTAGG - Intergenic
940693018 2:156943508-156943530 TGAGGTCAGCAAAATGGGGATGG + Intergenic
941606688 2:167606022-167606044 TAAGGTGACAGGAATGGGGCAGG - Intergenic
944134229 2:196380700-196380722 TAACGGCAGCAGAATGGGTTTGG - Intronic
946855350 2:223945010-223945032 TAAGGGGCGCAGAGTGGGGGTGG + Intronic
947224437 2:227826371-227826393 CAAGCTGAGCAGAATGGTGGTGG - Intergenic
1173034291 20:39393904-39393926 TGAGATGTGCAGAATTGGGTGGG - Intergenic
1173362371 20:42356134-42356156 AAAGGTGAGAAAAATGGGATGGG + Intronic
1173430656 20:42984556-42984578 TGAGCTGAGCATCATGGGGTAGG - Intronic
1174107334 20:48172006-48172028 GAAGGAGAGGAGAATGGGATGGG - Intergenic
1174202706 20:48818503-48818525 TAAGGAGAACAGAATGCGGGAGG + Intronic
1174406239 20:50305152-50305174 TAAAATGAGCAGAGTGGGCTGGG - Intergenic
1174705453 20:52650900-52650922 TTAGGTGACCAGGATGAGGTAGG - Intergenic
1175990249 20:62785222-62785244 AAGGGTGAGGGGAATGGGGTGGG + Intergenic
1177208651 21:18042284-18042306 GAAGGTTTGCAGAAGGGGGTGGG - Intronic
1177745204 21:25204402-25204424 TAAGGAGAGAAGAAAGGGATAGG + Intergenic
1178664235 21:34532873-34532895 TAAGGTGGGCAGTGGGGGGTTGG - Intronic
1179646589 21:42779659-42779681 TAACATGAGCTGACTGGGGTGGG + Intergenic
1180462421 22:15577353-15577375 TAAGGTCAGCTGAATGGCTTAGG + Intergenic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1182659509 22:31915380-31915402 GCAGGTGAGGAGGATGGGGTGGG + Intergenic
1183978220 22:41525345-41525367 CAAGGTCAGCAGCATGGGGACGG + Exonic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1185030766 22:48441747-48441769 TGAGGTGAGCAGGCAGGGGTGGG - Intergenic
1185311793 22:50160181-50160203 GAAGGGCAGCAGAAAGGGGTGGG - Intronic
951518602 3:23589456-23589478 CAAGGTGAGAAGTATGTGGTGGG + Intronic
951613603 3:24519581-24519603 TAAGGGGAGCAGAATTGGGCAGG - Intergenic
951694257 3:25429094-25429116 TAAGGAGAGGAGCATGGGGGCGG - Intronic
953703752 3:45215907-45215929 TGAGGGAAGCAGAATGGGGCAGG - Intergenic
953889891 3:46743847-46743869 TCAGATGAGCAGGATGGGATGGG - Intronic
954089456 3:48272894-48272916 AAAGCTGACGAGAATGGGGTAGG - Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
959541722 3:107547744-107547766 GAAGGAGAGCAGAGTGAGGTGGG - Intronic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
960141925 3:114159403-114159425 AAAGGTGAGCTGACTGGGGTTGG - Intronic
960601999 3:119468167-119468189 TGAGCTGAGCAGAAGGGGTTGGG + Intronic
961017203 3:123477515-123477537 TTGGGTGAGAAGAAAGGGGTTGG + Intergenic
962070893 3:132033497-132033519 AAAGGTGAGCAGAGTGAGGCGGG - Intronic
964922392 3:161913105-161913127 TAAGTTGAAAAAAATGGGGTCGG - Intergenic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
968449537 4:668765-668787 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449548 4:668802-668824 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449573 4:668895-668917 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449584 4:668932-668954 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449595 4:668969-668991 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449620 4:669062-669084 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449631 4:669099-669121 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968449642 4:669136-669158 TAGTGGGAGCAGCATGGGGTAGG - Intronic
968704779 4:2072778-2072800 TGAAGTGAGCAGAGTCGGGTGGG + Intronic
968811127 4:2800118-2800140 TGACGTGACCAGGATGGGGTCGG + Intronic
970551540 4:17186570-17186592 GAAGATGAGAAGAGTGGGGTGGG - Intergenic
975106972 4:70578707-70578729 CAAGGTGAGATGAATGGAGTAGG - Intergenic
975109502 4:70607960-70607982 GAAGGTGAAGAGAAGGGGGTAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
978609878 4:110525935-110525957 TAAGGTGAGCAAATTGGTGTGGG + Intronic
981748983 4:148075420-148075442 TAAGCTGAGCACAGTAGGGTTGG + Intergenic
982897673 4:160954002-160954024 TAAGGGCAGCAGAATGGGAAAGG - Intergenic
984165318 4:176298122-176298144 TAAGCTGAGAAGATTGGGGAAGG + Intergenic
986706789 5:10459533-10459555 TGAGGTCAGCGGGATGGGGTGGG - Intronic
988028909 5:25737852-25737874 TAAGGTGAAAAGAGTAGGGTGGG + Intergenic
993655348 5:90571724-90571746 TGAAGGGAACAGAATGGGGTAGG - Intronic
994055489 5:95409652-95409674 GAAGGTCAGCAGAATCTGGTTGG - Intronic
999141637 5:149366198-149366220 CAAGGTGCTCAGAATGGGCTGGG + Intronic
999299900 5:150484968-150484990 TAAAATGAGCAGGGTGGGGTTGG - Intergenic
1001685667 5:173593117-173593139 TAATGTGAGCAGCCTGGGGCAGG + Intergenic
1002823717 6:753783-753805 CACGGTGAGAAGAGTGGGGTTGG + Intergenic
1003007691 6:2397150-2397172 GAAGGGCAGCAGAATGGAGTGGG - Intergenic
1004546581 6:16603812-16603834 AGAGGTGAGCAGGCTGGGGTGGG + Intronic
1005459393 6:26054033-26054055 TAAAGTGAGGTGAATGGAGTAGG + Intergenic
1006282884 6:33069442-33069464 AAAGGTGAGCAGAGTGAGGCTGG - Intronic
1006808953 6:36807609-36807631 GAAGATGAGCAGAAAGGAGTGGG - Intronic
1006841875 6:37033686-37033708 TAAGGTGAGGACAAAGGTGTGGG - Intergenic
1006970010 6:38033183-38033205 TAAGAAGATCAGAAAGGGGTTGG + Intronic
1008241461 6:49117838-49117860 TAAAGTAAGCAGAATTGGATTGG + Intergenic
1009967907 6:70596395-70596417 GAAGGAAAGGAGAATGGGGTAGG - Intergenic
1011259513 6:85456623-85456645 GAAGATGAGCAGAAAAGGGTGGG + Intronic
1015524498 6:134162826-134162848 AAGAGTGAGCAGAATGGTGTTGG + Intergenic
1017278151 6:152594036-152594058 AAAATTGAGCAGAATGGGATGGG - Intronic
1018219334 6:161562674-161562696 TGAGATGAGCAAAATGGGGCAGG - Intronic
1018884938 6:167927372-167927394 TAAGGAGAGCAGAATAAGGAAGG + Intronic
1019275670 7:174298-174320 TAAGGGGTGCAGAAAGGGTTTGG - Intergenic
1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG + Intronic
1020142387 7:5619723-5619745 TTAGGTGGGCAGACTGGGGAAGG + Intergenic
1021681366 7:23136706-23136728 TCAAGTGTTCAGAATGGGGTGGG - Intronic
1021689098 7:23214927-23214949 TAAGGTTTGGAAAATGGGGTTGG - Intergenic
1021813395 7:24425056-24425078 TGAGGTGAGTATGATGGGGTGGG - Intergenic
1024779632 7:52832697-52832719 TGAGGTGAGCAGAATATGGGGGG - Intergenic
1025724972 7:64048006-64048028 TTTAGTGAGCAGAATGGGGGTGG + Intronic
1025754003 7:64316559-64316581 TTTAGTGAGCAGAATGGGGGTGG + Intronic
1025788759 7:64668075-64668097 TTAAATGAGCAGGATGGGGTAGG + Intronic
1025802144 7:64796323-64796345 TTAAGTGAGCAGGATGGGGTGGG + Intronic
1025815358 7:64905723-64905745 TTAAGTGAGCAGGATGGGGTGGG + Intronic
1025825114 7:65004737-65004759 TTAAGTGAGCAGGATGGGGGTGG - Intronic
1028332623 7:89614438-89614460 TAAATTGAGCAGACTGGAGTAGG + Intergenic
1030669804 7:112323579-112323601 TAAGGGGAGGAGAATGGAATGGG + Intronic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032848875 7:135775370-135775392 TAAGCTGAGAAGACTGGGTTAGG + Intergenic
1033136168 7:138786284-138786306 TAAAGAGAACAGAATGGGCTGGG + Intronic
1034427980 7:151024402-151024424 GATGGTGAGCCGAATGGGCTGGG - Exonic
1034434428 7:151056561-151056583 AAAGGTGAGGAGAGTGGTGTTGG - Exonic
1034573609 7:151978860-151978882 TAAGGTGAGCTCATTAGGGTAGG - Intronic
1037931466 8:22882897-22882919 TAGGGTGAGCAGGGTTGGGTTGG - Intronic
1039008066 8:33063124-33063146 TAAGTTGAGCAGAAAGTGTTTGG - Intergenic
1039836240 8:41258565-41258587 TAAGGGGAGAAGGAGGGGGTGGG - Intergenic
1040380249 8:46865245-46865267 TCAGGTGGGCACAAAGGGGTAGG - Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1045316200 8:101045819-101045841 CAGGGTGAGTAGAATGGGATAGG + Intergenic
1045865168 8:106857156-106857178 TCACAGGAGCAGAATGGGGTGGG + Intergenic
1047381656 8:124371039-124371061 AAAGGAGTCCAGAATGGGGTAGG - Intronic
1047412718 8:124637408-124637430 AAACCTGAGCAGCATGGGGTGGG + Intronic
1048190836 8:132286897-132286919 TAAAGTGAGCAAAATGGGAGAGG - Intronic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1056087545 9:83166669-83166691 TCAGGTGACCAGGCTGGGGTGGG - Intergenic
1061406647 9:130396081-130396103 TAAGGTGGGCAGGGTGGGGTGGG - Intronic
1061520176 9:131113115-131113137 CAAGGTTAGCAGACTGTGGTAGG + Intronic
1061564584 9:131429665-131429687 TAAGGCTAGCAGAATAGGGGAGG - Intronic
1062529503 9:136993712-136993734 TATGGTGTGGAGAAAGGGGTGGG - Intronic
1189860216 X:45263958-45263980 TAGGGTGAGCTGAATGGGGCAGG + Intergenic
1189921754 X:45909335-45909357 CAAGGTGAGCAGTTTAGGGTTGG + Intergenic
1190454205 X:50610185-50610207 TGAGCTGACCAGAATGGGGGAGG - Intronic
1190481742 X:50884256-50884278 TAAGTTGAGCAGAAAGGGCTTGG - Intergenic
1190909062 X:54755608-54755630 TAAGGGCAGCAGGAAGGGGTAGG + Intronic
1192913946 X:75634571-75634593 TAAGGTGAGAAGCATAGGGGTGG + Intergenic
1197713426 X:129688469-129688491 TGGGGTGAGGAGAATGGGGCTGG + Intergenic
1199162307 X:144627947-144627969 TGAGCTGTGCAGTATGGGGTTGG - Intergenic
1199314769 X:146363764-146363786 CAAGCTGTGCAGCATGGGGTTGG + Intergenic
1199947468 X:152680372-152680394 TCAGGTCAGCAGGCTGGGGTGGG + Intergenic
1199962212 X:152788082-152788104 TCAGGTCAGCAGGCTGGGGTGGG - Intergenic
1201684832 Y:16689209-16689231 TAGGGTGAGGGGAAGGGGGTGGG + Intergenic
1202305524 Y:23466077-23466099 TCAGGTGAGCAGAAGAGGCTGGG + Intergenic
1202565285 Y:26204512-26204534 TCAGGTGAGCAGAAGAGGCTGGG - Intergenic