ID: 1164029231

View in Genome Browser
Species Human (GRCh38)
Location 19:21386211-21386233
Sequence TCTTATGTGCAGAAAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164029231_1164029233 -8 Left 1164029231 19:21386211-21386233 CCCTCAACTTTCTGCACATAAGA No data
Right 1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG 0: 2
1: 8
2: 15
3: 48
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164029231 Original CRISPR TCTTATGTGCAGAAAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr