ID: 1164029233

View in Genome Browser
Species Human (GRCh38)
Location 19:21386226-21386248
Sequence ACATAAGATAATTTATACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 2, 1: 8, 2: 15, 3: 48, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164029230_1164029233 -7 Left 1164029230 19:21386210-21386232 CCCCTCAACTTTCTGCACATAAG No data
Right 1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG 0: 2
1: 8
2: 15
3: 48
4: 332
1164029229_1164029233 4 Left 1164029229 19:21386199-21386221 CCTTTAATGGTCCCCTCAACTTT No data
Right 1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG 0: 2
1: 8
2: 15
3: 48
4: 332
1164029232_1164029233 -9 Left 1164029232 19:21386212-21386234 CCTCAACTTTCTGCACATAAGAT No data
Right 1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG 0: 2
1: 8
2: 15
3: 48
4: 332
1164029231_1164029233 -8 Left 1164029231 19:21386211-21386233 CCCTCAACTTTCTGCACATAAGA No data
Right 1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG 0: 2
1: 8
2: 15
3: 48
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164029233 Original CRISPR ACATAAGATAATTTATACTG TGG Intergenic
902093927 1:13926765-13926787 ACATATCATATTTGATACTGGGG + Intergenic
907223722 1:52926446-52926468 ACATAAGATAAAATAAACCGGGG + Intronic
907592377 1:55687364-55687386 AAATAAGATAATTTATCTTATGG + Intergenic
907613389 1:55896328-55896350 AAATAAGATAATTAATACATAGG - Intergenic
907977932 1:59450955-59450977 AGATAAGATTAATCATACTGTGG - Intronic
908378935 1:63575908-63575930 ACATATTCTAATTTATAATGGGG + Intronic
908573084 1:65429705-65429727 ACATAAGATGATTTCTACCAGGG - Intronic
909700802 1:78520449-78520471 AAACAAGATAATTTATACACTGG + Intronic
909831254 1:80193261-80193283 ACATAATATTATTTGGACTGAGG + Intergenic
910693516 1:89989023-89989045 ACTTAAAGTAATTTCTACTGAGG - Intergenic
911008814 1:93256544-93256566 ACATAAGATTATTTAAAATAGGG - Intronic
915957576 1:160235038-160235060 ATATAAATTAATTTATATTGGGG - Intronic
917049169 1:170899189-170899211 ACATAAAATAATCTTTACTTTGG - Intergenic
917187749 1:172379905-172379927 AGATAAGATAGGTTATAATGAGG + Intronic
918608887 1:186463867-186463889 AAATAAGAAAATATATATTGAGG - Intergenic
918686732 1:187426347-187426369 ATATAATATTATTTATTCTGAGG + Intergenic
918777199 1:188648879-188648901 AGACAAGATAACTTAGACTGTGG - Intergenic
918794779 1:188879719-188879741 AAATTTAATAATTTATACTGTGG - Intergenic
918909454 1:190547073-190547095 ACAAAAAATGATTTATAATGAGG - Intergenic
922217878 1:223535320-223535342 ACACAGGATAATTTTGACTGCGG + Intergenic
923283367 1:232466460-232466482 GCATAAGATAAATTATACAGTGG + Intronic
923873556 1:238022257-238022279 ATGTTAGAAAATTTATACTGAGG - Intergenic
1064427234 10:15240371-15240393 ACATAAAATTATTTTTATTGAGG + Intronic
1065114826 10:22475506-22475528 ACATTAGATAATTTACAACGAGG - Intergenic
1065620511 10:27576320-27576342 ACATAAGATAATATATTCACAGG + Intergenic
1066670387 10:37831449-37831471 TCATTAGAAAATTTGTACTGAGG - Exonic
1067423197 10:46177185-46177207 AAAAAAGATAATTAATGCTGTGG - Intergenic
1067511394 10:46897778-46897800 AAATGAGATAATATATACAGTGG - Intergenic
1067650853 10:48154084-48154106 AAATGAGATAATATATACAGTGG + Intergenic
1067788045 10:49265619-49265641 ACATAAGATAAATTAACCTGAGG + Intergenic
1068710193 10:60125619-60125641 ACATAAGCTAATTTCTAAGGGGG - Intronic
1069147174 10:64908418-64908440 ACAGTACATAATTTATATTGGGG - Intergenic
1069245135 10:66194895-66194917 GCATAACATAAAATATACTGAGG - Intronic
1071413398 10:85419045-85419067 ACATAAGTTCATTTATACTCTGG + Intergenic
1071851077 10:89571131-89571153 TCATAATATAAGTTATAATGAGG + Intergenic
1073375883 10:103034050-103034072 ACAGAAGATAATTAATACATTGG + Intronic
1073888142 10:108065475-108065497 ACATAAGAAAACTCAGACTGAGG + Intergenic
1074718169 10:116239759-116239781 TCAAAAGATAATTTATACTTGGG + Intronic
1075128526 10:119720531-119720553 ACAGAAGAAAATTTATGATGAGG + Intergenic
1076005144 10:126942859-126942881 AACTAAAAGAATTTATACTGAGG - Intronic
1078721412 11:13887555-13887577 ACATAAGATAATATATTCATGGG - Intergenic
1079288788 11:19166886-19166908 ACATTAGATCACTTATTCTGCGG + Intronic
1080344456 11:31308939-31308961 ACATATGTTAATTTATAATTGGG - Intronic
1085977105 11:81670146-81670168 AAATAAAAAAATTTATGCTGAGG - Intergenic
1086823905 11:91471300-91471322 AAATAAGATAATGTATTATGGGG + Intergenic
1087950447 11:104214344-104214366 AGATAATATAATTTATATTTGGG - Intergenic
1089060015 11:115618761-115618783 ACAGAAAATATTTTATACAGGGG + Intergenic
1089648845 11:119898513-119898535 ACTTAAGGAAATTTACACTGTGG + Intergenic
1092398942 12:8155201-8155223 ACCTAAGATTAATAATACTGGGG - Intronic
1093180681 12:15963984-15964006 ATATAAGAGAATAAATACTGAGG - Intronic
1093993561 12:25616998-25617020 ACATAATGTAAATTATATTGAGG - Intronic
1095290210 12:40470080-40470102 ACATATGTTATTTTATACTTTGG - Intronic
1095862203 12:46930032-46930054 ACATAAGAGAAAATCTACTGAGG - Intergenic
1097816659 12:64082080-64082102 ACTTAGGATAATTTATGCTTTGG - Intronic
1097912896 12:64989726-64989748 AGATAAGCTAGTTTCTACTGAGG + Intergenic
1098025033 12:66192315-66192337 TCACAAGATAATATATTCTGTGG + Intronic
1099858362 12:88199611-88199633 GCCTAAGATAAATTATACTTAGG + Exonic
1102415021 12:112753811-112753833 ACATAAGATAATATATTCACAGG - Intronic
1102814804 12:115856690-115856712 ACTTAAAAAAATTCATACTGCGG - Intergenic
1102922593 12:116803393-116803415 ACAGAAAATAATATATAATGGGG + Intronic
1103591072 12:121992868-121992890 ACATAAGATAAATTATAATTTGG - Intronic
1104298612 12:127542066-127542088 ACATAGAATAATTTGTACTATGG + Intergenic
1104564566 12:129869125-129869147 GCATAAGACAATGTATAATGGGG - Intronic
1105488775 13:20865493-20865515 ACCTAAAATAATTTATTCTCTGG - Intronic
1107144687 13:37047260-37047282 GCAAAAGATAATATATACTGTGG + Intronic
1109517256 13:63459994-63460016 ACATAAGAGAATTTGTTCTTTGG + Intergenic
1109613893 13:64805257-64805279 ACATAAGCCAATTTATAATAAGG - Intergenic
1109624827 13:64961259-64961281 AACTAACATAAATTATACTGGGG - Intergenic
1109743345 13:66585595-66585617 AGATAAAATAATGAATACTGGGG - Intronic
1109929715 13:69198820-69198842 ACTTGGGATAATTTATACTCTGG - Intergenic
1110075290 13:71232726-71232748 AAATAAGATATTATATAATGAGG + Intergenic
1110371897 13:74750011-74750033 ACATAATAAAATCTATAATGTGG + Intergenic
1111710680 13:91809178-91809200 ACATCAGATATTTTATACTCTGG + Intronic
1112683006 13:101788379-101788401 ACATAGGAAAATTAATTCTGGGG + Intronic
1113321580 13:109237471-109237493 ATATAAGATATATTCTACTGGGG + Intergenic
1114308757 14:21446807-21446829 TTATAAGATAATTTATAATGGGG - Intronic
1114312497 14:21479812-21479834 AAATAACAAAATTTAAACTGTGG - Intronic
1114514303 14:23287590-23287612 ACATAAGATGATGTCTAATGGGG + Intronic
1115293795 14:31802742-31802764 AAATAAGACAATTGATAATGAGG + Intronic
1116305613 14:43251165-43251187 ACATAAGATAAAATATTTTGTGG + Intergenic
1120466035 14:84858984-84859006 AGATAATAAAATTCATACTGAGG + Intergenic
1120514710 14:85457019-85457041 AGATGAGATAATTTATAAAGAGG - Intergenic
1123141708 14:106086376-106086398 CAATAAGAGAATTAATACTGTGG - Intergenic
1123200173 14:106656024-106656046 CAATAAGAGAATTAATACTGAGG - Intergenic
1123753350 15:23375857-23375879 GCATCAGATACTTTATACTCTGG - Intergenic
1124985961 15:34614018-34614040 GCATCAGATATTTTATACTCCGG + Intergenic
1125121155 15:36160096-36160118 AAATAAGATAAATGACACTGGGG + Intergenic
1126628361 15:50708324-50708346 CCGTAAGATAATTTAAACTTTGG + Intronic
1127742602 15:61927073-61927095 ACACAAGGTAATTCTTACTGTGG + Exonic
1129186562 15:73910906-73910928 ACATAAGATAATTTCTTGTAAGG - Intergenic
1130290945 15:82600506-82600528 ATATAAGATACTTTCTTCTGGGG + Intronic
1131203315 15:90419763-90419785 TAATAAAATAATTTATTCTGAGG + Intronic
1131429776 15:92377491-92377513 ACCTAGGATAATTGGTACTGGGG + Intergenic
1132167892 15:99614156-99614178 ACATGAGATAATATATATTAAGG + Intronic
1133753201 16:8740706-8740728 ACATAAGATTATTAATTTTGGGG - Intronic
1134188387 16:12101688-12101710 ACATAAGATGATTAAAACTGGGG - Intronic
1135274196 16:21097197-21097219 ACATCAGATAATTTTGACTGTGG + Intronic
1136870724 16:33805089-33805111 CAATAAGAGAATTAATACTGTGG + Intergenic
1137851540 16:51750859-51750881 ACATGAAATAAATAATACTGTGG + Intergenic
1138298688 16:55908742-55908764 ACATAAGATGAACTAAACTGCGG - Intronic
1138879832 16:60999442-60999464 AAATACGATATTTTATATTGAGG + Intergenic
1138940968 16:61789171-61789193 ACACAAAATAACTTACACTGTGG - Intronic
1139669663 16:68484094-68484116 CCACAAGATCATTAATACTGAGG + Intergenic
1140464550 16:75169797-75169819 ACATCAGAGAATTCACACTGGGG + Exonic
1203101448 16_KI270728v1_random:1310969-1310991 CAATAAGAGAATTAATACTGTGG - Intergenic
1143859747 17:9880112-9880134 ACATATGACAATCTATACAGGGG + Intronic
1144089479 17:11841523-11841545 ACATAAGATAATATAAACATAGG + Intronic
1144310423 17:14008937-14008959 AGATAGGACAGTTTATACTGTGG + Intergenic
1144601804 17:16622473-16622495 ACATCAGAGAATTCATACTGGGG - Exonic
1145052865 17:19677564-19677586 ACATAAAATGATTTATAGTTGGG - Exonic
1146482612 17:33217119-33217141 ACAAAATATAATTTAGACTTTGG + Intronic
1149120135 17:53152704-53152726 TTATAAGATATCTTATACTGGGG - Intergenic
1150992487 17:70275927-70275949 ACATAAGATAATGTTTATGGAGG + Intergenic
1151012251 17:70514247-70514269 ACATGAGATAATTTAACCTTGGG + Intergenic
1151029312 17:70717795-70717817 ATATATAATTATTTATACTGAGG + Intergenic
1151248150 17:72812104-72812126 ATATAATATCATTTATACTAAGG - Intronic
1151846943 17:76663210-76663232 AAATAAGATAATCTAAATTGCGG - Intergenic
1153090935 18:1341884-1341906 ACCTAAAATAAGTTTTACTGGGG + Intergenic
1153859105 18:9181824-9181846 AAATAAAATAATGTATACAGTGG + Intronic
1155583351 18:27337522-27337544 GCATTTGATATTTTATACTGTGG - Intergenic
1156240168 18:35246115-35246137 ACATCAGAGAATTCATAGTGGGG + Exonic
1156775507 18:40783021-40783043 ACATAACATAATGTGTACTTGGG - Intergenic
1157224713 18:45852455-45852477 ACATACGATAGTTAACACTGAGG - Exonic
1157922683 18:51729816-51729838 ACATAATTTAATTTTTAATGAGG - Intergenic
1158305480 18:56100759-56100781 ACATAACATAATTCAAGCTGGGG - Intergenic
1159150609 18:64518577-64518599 ACTTAAGAGAATTTTCACTGTGG - Intergenic
1159953200 18:74500478-74500500 AAATAAGCTAATTTGGACTGTGG + Intronic
1162259454 19:9520711-9520733 AAATAAGATAATTCATTTTGGGG - Intergenic
1162655188 19:12123736-12123758 ACATAAGATAATATCTGATGGGG - Intronic
1162657901 19:12145602-12145624 ACATAAAATAACTCACACTGGGG - Exonic
1163882173 19:19934785-19934807 ACATGAGATAATTCATACTGGGG + Exonic
1163946889 19:20545611-20545633 ACATAAGAAAATTCATACTGGGG - Exonic
1163961252 19:20695735-20695757 ACATAAGATAATTCATACTAAGG + Intronic
1163961263 19:20695819-20695841 ACCTAAGATAATTTATACTAAGG + Intronic
1164009171 19:21183134-21183156 ACATAAGATAATTCATACTGGGG + Exonic
1164029233 19:21386226-21386248 ACATAAGATAATTTATACTGTGG + Intergenic
1164075043 19:21808098-21808120 ACATAAGATAATTCACACTGAGG - Exonic
1164104069 19:22089178-22089200 ACATAAAATAATTCATACTGGGG + Exonic
1164125716 19:22314764-22314786 ACATAAGATAATTCATACTGGGG + Exonic
1164125752 19:22315184-22315206 ACATAAGGTAATTCATACTAGGG + Exonic
1164125788 19:22315688-22315710 ACATAAGGTAATTCATACTAGGG + Exonic
1164125838 19:22316360-22316382 ACATAAAGCAATTCATACTGGGG + Exonic
1164125846 19:22316444-22316466 ACATAAGCTAATTCATACTAGGG + Exonic
1164125851 19:22316528-22316550 ACATAAGATAATTCATACTGGGG + Exonic
1164125874 19:22316780-22316802 ACATAAGATAATTCATACTGGGG + Exonic
1164125908 19:22317198-22317220 ACATATGATAATTCACACTGGGG + Intergenic
1164141617 19:22472563-22472585 ACATAAGATAATTTATACTGGGG + Intronic
1164174332 19:22756216-22756238 ACATAAGATAATTCATACTGGGG - Intronic
1164174368 19:22756632-22756654 ACATAAGATAATTCATACTGGGG - Intronic
1164174376 19:22756716-22756738 ACATAAGATAATTCATACTGGGG - Intronic
1164174396 19:22756966-22756988 ACATAAGATAATTCATACTGGGG - Intronic
1164174403 19:22757050-22757072 ACATAAGCTAATTCATACTAGGG - Intronic
1164174495 19:22758141-22758163 ACATAAAGCAATTCATACTGGGG - Exonic
1164215846 19:23146451-23146473 ACATAAGATAATTCATTCTGGGG + Exonic
1164269024 19:23653420-23653442 ACATAAAAGAATTCATACTGGGG - Exonic
1165263396 19:34639890-34639912 AGATAAGCTAGTTTCTACTGAGG + Intronic
1165536282 19:36449144-36449166 ACATCAGAGAATTCATACTGGGG - Exonic
1165536297 19:36449312-36449334 ACATCAGAGAATTCATACTGGGG - Exonic
1165565213 19:36720290-36720312 ACATCAGAGAATTCATACAGGGG + Exonic
1165568126 19:36750376-36750398 ACATCAGAGAATTCATACTGGGG - Exonic
1165589040 19:36949954-36949976 ACATCAGAAAATTCATACTGGGG + Exonic
1165608403 19:37127963-37127985 ACATCAGAAAATTCATAATGGGG + Exonic
1165610982 19:37152344-37152366 ACATCAGAGAATCCATACTGGGG - Exonic
1165614349 19:37185982-37186004 ACATCAGAGAATCCATACTGGGG - Exonic
1165643642 19:37413271-37413293 ACACCAGAGAATTCATACTGGGG - Exonic
1165643674 19:37413691-37413713 ACATCAGAAAGTTCATACTGGGG - Exonic
1166021450 19:40034360-40034382 ACATCAGAAAATTCATACTTGGG - Exonic
1166587784 19:43966399-43966421 ACATCAGAGAATCCATACTGGGG + Exonic
1166590791 19:43996688-43996710 ACATAAGAGAATCCATACTGGGG + Exonic
1166592334 19:44010846-44010868 ACATCAGATAATTCATACTGGGG + Exonic
1166594369 19:44032412-44032434 ACATCACAGAATTCATACTGGGG + Exonic
1166607392 19:44156847-44156869 ACATCAGAGAATTCATACTGGGG + Exonic
1166638898 19:44477013-44477035 ACATCAAAGAATTCATACTGGGG - Exonic
1167872596 19:52385191-52385213 ACATGAGAGAATTCATACTGGGG + Exonic
1167878902 19:52438657-52438679 ACATAGGAAAATTCATACTGGGG + Exonic
1167911402 19:52705536-52705558 TCATAAGTCAATTCATACTGGGG - Exonic
1167941557 19:52950175-52950197 ACATAGGAGAATTCATACTGGGG - Exonic
1167993596 19:53383203-53383225 TCATAAGACAATTCACACTGGGG + Exonic
1168016410 19:53577088-53577110 ACATCAAAAAATTCATACTGGGG + Exonic
1168016491 19:53577760-53577782 ACATGAGAGAATTCATACCGGGG + Exonic
1168531715 19:57135175-57135197 ACATAAAAAAATCCATACTGGGG - Exonic
1168604967 19:57751335-57751357 AAACAAGATAATTTATAAGGAGG - Intronic
926504073 2:13689201-13689223 AAATAAGAAAATGTACACTGAGG - Intergenic
927446649 2:23168444-23168466 ATATAAAATACTTTATTCTGTGG + Intergenic
927898806 2:26803964-26803986 AAATAAGATAAATTATTCTCTGG - Intergenic
929267060 2:39929814-39929836 ACATCAGAGAATCCATACTGGGG + Intergenic
929335689 2:40742318-40742340 ACTTAAGCTAAATTATTCTGTGG + Intergenic
929434362 2:41916301-41916323 ACATAAGATAATTCCCACTGAGG + Intergenic
931047328 2:58370263-58370285 AAATTAAATAGTTTATACTGTGG + Intergenic
932651367 2:73561502-73561524 ACTTTAGATATTTCATACTGAGG - Intronic
933233209 2:79833199-79833221 TCACAAGATAATTTTTACTGTGG + Intronic
934536921 2:95141914-95141936 ATTCAAGATAATTTATTCTGAGG - Intronic
935477586 2:103542473-103542495 ACATATGAAATTTTACACTGAGG - Intergenic
935797654 2:106660669-106660691 CCATAAGATAATTTCTGCTTAGG + Intergenic
936698845 2:114985398-114985420 ACGCAAGATAATTTAGACTGTGG - Intronic
936728306 2:115349908-115349930 ACATAAGATAATTTTGACTGGGG - Intronic
937604968 2:123788676-123788698 ATATAATTTAATTTACACTGTGG - Intergenic
938684640 2:133726214-133726236 ACAGAAGATATTTTATGCTAAGG + Intergenic
939112175 2:138021198-138021220 ATATAACATAAGTTATATTGAGG + Intergenic
940246600 2:151625533-151625555 AAATAAAATAAATTATAGTGAGG - Exonic
942361085 2:175172070-175172092 AAACAAGATAATTTAAATTGTGG + Intergenic
942767347 2:179472509-179472531 GAATAAGATAATCTCTACTGTGG + Intronic
943125127 2:183787078-183787100 ACTTAAGATAATTAATATTAAGG - Intergenic
943384611 2:187185804-187185826 ACATAAGAAAATTAAAACTTGGG + Intergenic
944099850 2:196012253-196012275 ACATATGATAATTCATAATCTGG - Intronic
944368073 2:198947887-198947909 ACATCAGATCCTTTATACTCTGG + Intergenic
944840946 2:203623163-203623185 AAATAAGATCATTTCTCCTGAGG - Intergenic
945356637 2:208847947-208847969 ACATAAGAATATATTTACTGTGG - Intronic
946810270 2:223516336-223516358 AAATAAAATGATTTAAACTGTGG - Intergenic
1169509874 20:6251855-6251877 ACAGAAAAGAATATATACTGTGG + Intergenic
1170397288 20:15940405-15940427 TTTTAAGATAATTTCTACTGTGG + Intronic
1170876772 20:20257252-20257274 ACGGAAGATAATTTTTTCTGAGG - Intronic
1173890247 20:46502555-46502577 ACATCAGAGAATTCATACAGGGG - Exonic
1177077256 21:16592106-16592128 ACAGAAGTTAATATATAGTGTGG - Intergenic
1177149058 21:17436413-17436435 CCATAAGATATTCTTTACTGGGG + Intergenic
1177959987 21:27651777-27651799 CCATAAGATAATGTGAACTGAGG - Intergenic
1180892767 22:19302427-19302449 ACTTAAAATAATTTCTATTGAGG - Intergenic
1182188530 22:28433946-28433968 AAATAAGATAATATTTATTGTGG - Intronic
1183886115 22:40883777-40883799 ACTAAAGATAGTTTATAATGTGG - Intronic
949147707 3:722656-722678 AGATAAAATAATTGATAGTGAGG + Intergenic
949748827 3:7327427-7327449 ACATAATAGAATTTAAATTGAGG - Intronic
949818271 3:8085895-8085917 AAATAAGATAATGTATACACAGG + Intergenic
951169491 3:19523461-19523483 TTATAAGATAAATTATACTGAGG + Intronic
951281752 3:20758948-20758970 AAATAATTTTATTTATACTGAGG + Intergenic
952646640 3:35667493-35667515 ACATAAGTTATTTTAAAATGAGG - Intronic
952662968 3:35874145-35874167 ACATAACATAATGTCTGCTGGGG - Intergenic
952710197 3:36423470-36423492 ACATTTCATAATATATACTGGGG - Intronic
953173985 3:40532610-40532632 CCATCAGAGAATTCATACTGGGG + Exonic
953642443 3:44721753-44721775 ACATCAGAGAATTCACACTGGGG + Exonic
953864970 3:46576140-46576162 ACGTAAAATAATTTGTATTGGGG - Intronic
955760429 3:62274794-62274816 CCATGAGATAATTAATAATGAGG + Intronic
957237500 3:77613142-77613164 ACATAAGAAAAGTTATAATTTGG - Intronic
957734227 3:84186549-84186571 ACATCATCAAATTTATACTGAGG + Intergenic
957740624 3:84263407-84263429 ACATAAGACAATTTTTATTTTGG + Intergenic
959549048 3:107633022-107633044 CCATCTGATAATTTGTACTGTGG + Intronic
960422395 3:117463226-117463248 ACATCAGATTATATAAACTGTGG + Intergenic
961106302 3:124244742-124244764 ACATAAAAAGATTTTTACTGAGG - Intronic
961844453 3:129749745-129749767 ACATAAAATACTTTATTGTGAGG + Intronic
961850311 3:129810415-129810437 AAAACAGGTAATTTATACTGTGG + Intronic
963261374 3:143194677-143194699 GTATAAAATAATTTATACTTTGG - Intergenic
963754578 3:149220877-149220899 ACAGAAGTTTATCTATACTGAGG - Intronic
967078611 3:186027851-186027873 ACATAAGAAAATTAAAATTGAGG - Intergenic
967468260 3:189832714-189832736 CCATAAGACACTTTACACTGTGG + Intronic
968155013 3:196373695-196373717 AAAGAAAATAATTTATTCTGGGG - Intronic
968155038 3:196373856-196373878 TTAGAAGATAATTTATTCTGGGG - Intronic
968356230 3:198109745-198109767 ACAGAAGATAATTTATTATAGGG - Intergenic
968409408 4:374507-374529 GCACAAGATAATTCATTCTGGGG + Exonic
968416647 4:442555-442577 ACAGAAGAAAATTTACACTGGGG - Exonic
969852069 4:9965535-9965557 ACATATGATAGTTTATTCTGTGG - Intronic
970749602 4:19341900-19341922 ACTTAAGAAAATTTATACTGTGG + Intergenic
971124216 4:23734972-23734994 ACAGAAGAAAATTTAGAGTGGGG + Intergenic
971640671 4:29128568-29128590 GCATATGCTAATTTATTCTGAGG + Intergenic
972225540 4:37007035-37007057 AAATAAGATAATGTATATTAAGG - Intergenic
973020197 4:45195155-45195177 ATATAAGATAATGAAAACTGTGG - Intergenic
973080295 4:45983071-45983093 ACATAAGATAACTTCTGATGAGG + Intergenic
973086727 4:46072475-46072497 ACAAGGGACAATTTATACTGTGG + Intronic
973538147 4:51905487-51905509 ATATAATAAAATTTATATTGAGG - Intronic
973539018 4:51916595-51916617 TCATAAAATAATTTCTATTGGGG + Exonic
975099180 4:70492714-70492736 ATATAAGAAAAGTTATACTTAGG + Intergenic
975670447 4:76774880-76774902 ACATAAGCTATTTTGTATTGAGG + Intronic
975972956 4:80064318-80064340 ATATAAGATTATTTATTATGTGG + Intronic
976427740 4:84925691-84925713 ACATATGGTAATTAATACAGTGG + Intronic
976618001 4:87097662-87097684 ACAGAAGAGAAGTGATACTGAGG + Intronic
978088485 4:104685718-104685740 ACATAAGCTAATATATATGGAGG - Intergenic
978227066 4:106349349-106349371 ACATTAGATAATTTGATCTGGGG - Intergenic
978599946 4:110417325-110417347 ACATCAGAGAGTTCATACTGGGG + Intronic
979002623 4:115243901-115243923 ACAAAAGATATCTTAGACTGGGG - Intergenic
979785368 4:124711298-124711320 ACATATGATATTTTGCACTGAGG - Intronic
979940524 4:126757240-126757262 ACATATGATCATGTATACTTTGG + Intergenic
980927605 4:139153797-139153819 ACATAAGATAAAGTAAACAGAGG - Intronic
981417974 4:144515670-144515692 AGATATGATAATTTTTAATGTGG - Intergenic
981766329 4:148254335-148254357 ACATATGAAAGTTTATACAGTGG + Intronic
981863310 4:149383003-149383025 AAAAAAGAAAAATTATACTGAGG + Intergenic
982328438 4:154154677-154154699 AATTATGATATTTTATACTGTGG + Intergenic
982912877 4:161166741-161166763 AAATAATATAATTTATACGGAGG + Intergenic
985700007 5:1365427-1365449 ACTTAAAATAATGTATACTCAGG + Intergenic
987822243 5:22980778-22980800 TAATAAAATAATTTATATTGAGG + Intergenic
987994416 5:25256819-25256841 AGAAAAGATAATACATACTGTGG - Intergenic
989031292 5:37121056-37121078 ATATAAGAAATTTTATACTTGGG + Intronic
991317732 5:65328790-65328812 ACATAAGATAGTTTTTCCTTTGG + Intronic
993408064 5:87536982-87537004 CCCTAAGATAATTTCTTCTGGGG + Intergenic
994574620 5:101562090-101562112 ACATATGATAATTATTACTTTGG + Intergenic
996185352 5:120466069-120466091 ACAGAACATAATTAGTACTGAGG + Intronic
996583061 5:125052970-125052992 AAATGAGTTAATTTATACTTGGG + Intergenic
996899679 5:128530159-128530181 TCATAAGATAATTATAACTGTGG - Intronic
998655645 5:144176276-144176298 GCATAAGATGATTTATATTGTGG + Intronic
998939656 5:147267523-147267545 AAATAAGATAATGTATATTAAGG + Intronic
999131053 5:149283634-149283656 AATTATGATAATTTATACTAAGG + Intronic
999353042 5:150895519-150895541 ACATCAGAGGATTCATACTGGGG - Exonic
999353075 5:150895855-150895877 ACATCAGTTAGTTCATACTGGGG - Exonic
999353102 5:150896107-150896129 ACATCAGAGAATACATACTGGGG - Exonic
999353123 5:150896275-150896297 ACATCAGAGAACTCATACTGGGG - Exonic
999355963 5:150931194-150931216 ACATCAGATAATTCATACTGGGG - Intergenic
999355983 5:150931428-150931450 ACATCAGAGAATACATACTGGGG - Intergenic
999356001 5:150931596-150931618 ACATCAGAGAACTCATACTGGGG - Intergenic
1000197254 5:158971713-158971735 ATATAAGAAGATTTTTACTGTGG + Intronic
1001003514 5:168029690-168029712 ACAGAAGATATTTTAGACAGTGG - Intronic
1002397024 5:178965691-178965713 ACATCAGAGAATTCATACTGGGG + Exonic
1002397033 5:178965775-178965797 ACATAAGAGAATTCATACTAGGG + Exonic
1002411338 5:179079719-179079741 ACATCGGAAAATTCATACTGGGG + Exonic
1003466091 6:6381412-6381434 ACACAAGATAAATAAAACTGGGG + Intergenic
1004072695 6:12315412-12315434 ACCTAAAAGAATATATACTGAGG - Intergenic
1005524975 6:26637848-26637870 ACATAAAAGAGTTCATACTGGGG - Exonic
1005684965 6:28245469-28245491 ACATCACAAAATTCATACTGGGG - Exonic
1005764230 6:28995180-28995202 ACATAAGCGAGTTCATACTGGGG - Exonic
1005910214 6:30302924-30302946 ACAAAAGGAAATTTATAATGGGG + Intergenic
1008088594 6:47270074-47270096 ACTTAAGAAAGTTTTTACTGGGG + Intronic
1008299017 6:49811433-49811455 AAAAAAGATAATTAATACAGGGG - Intergenic
1009960475 6:70514930-70514952 TGATAAGATAGTTTCTACTGAGG - Intronic
1011002824 6:82610088-82610110 ATATCAGGTAATTTATACTAAGG - Intergenic
1011161132 6:84391488-84391510 CCTGAAGATAATTTATACTAAGG + Intergenic
1012548100 6:100442577-100442599 ATATAAGATAATTTACTCTCTGG - Intronic
1014351109 6:120347227-120347249 TGATAAGTTAATTTATAATGAGG + Intergenic
1014553090 6:122811796-122811818 AATTAAGATAAGTTTTACTGTGG - Intergenic
1014578944 6:123110226-123110248 ACACAATATTATTTATTCTGAGG - Intergenic
1014889187 6:126821569-126821591 AACAAGGATAATTTATACTGTGG - Intergenic
1015107479 6:129553767-129553789 AAATAATATAATTTATATTTAGG + Intergenic
1016022402 6:139249991-139250013 GCATAAGACAATGTTTACTGTGG + Intronic
1017345658 6:153377499-153377521 ACAAAAGATAATCTATAATTAGG - Intergenic
1018255416 6:161913192-161913214 ACATGGGATAATGTATAATGTGG + Intronic
1019166445 6:170100579-170100601 AGAAAAGACAATGTATACTGAGG - Intergenic
1020491336 7:8788054-8788076 ATACAACATAATTTTTACTGAGG + Intergenic
1021049971 7:15971099-15971121 ACATAAGACAATTCGTACTATGG - Intergenic
1022892719 7:34717458-34717480 TGATAAATTAATTTATACTGAGG - Intronic
1023207051 7:37762672-37762694 AGATGAGATAATTGATACTCAGG + Intronic
1025163377 7:56686444-56686466 TCATAAGAGAATTCATACTAGGG - Intergenic
1025222126 7:57120787-57120809 ACATCAGGTAATTCATACTAGGG - Exonic
1025266872 7:57469067-57469089 ACATCAGATAATTCATACTAGGG + Exonic
1025266906 7:57469484-57469506 ACATAAGATAGTTCATACTGGGG + Exonic
1025632668 7:63289833-63289855 ACATTAGAGAATTTATATTGGGG - Intergenic
1025632909 7:63292459-63292481 ACATCAGGTAATTCATACTAGGG - Intergenic
1025649788 7:63455724-63455746 ACATCAGGTAATTCATACTAGGG + Intergenic
1025721105 7:64015371-64015393 ACATCAGATAATTCATACTAAGG + Intergenic
1025743227 7:64219657-64219679 ACATCAGATAATTCATACTAAGG + Intronic
1025748238 7:64266236-64266258 ACATCAGATAATTCATACTAGGG + Exonic
1025792805 7:64707087-64707109 CCATAAGAGAATTCATGCTGGGG + Exonic
1025805764 7:64832466-64832488 ACATAAGAAAATTCATACTGGGG + Intronic
1025822352 7:64978919-64978941 ACATAATATAATTCATACTGGGG - Exonic
1025867521 7:65399104-65399126 ACATAAGATAATCCATACTGGGG + Exonic
1026431975 7:70356750-70356772 ACATAAGGTAATTTTCAGTGTGG - Intronic
1027133325 7:75606809-75606831 ATATAAGATAATTCATACAAAGG - Intronic
1028100795 7:86817997-86818019 ACATAAGATAATGTCTAAGGAGG - Intronic
1028132786 7:87196159-87196181 AAATAAAATAATTTATACAAGGG - Exonic
1028433106 7:90771015-90771037 ACATAACATGATTCTTACTGAGG - Intronic
1028741212 7:94277981-94278003 TAATAAGATCGTTTATACTGAGG + Intergenic
1028818286 7:95175353-95175375 ACATAAATTAAATTATATTGTGG - Intronic
1029842161 7:103376493-103376515 CCATTAGATAATTGCTACTGTGG + Intronic
1030996103 7:116360590-116360612 ACATAACACATTTTATACTTGGG - Intronic
1033152089 7:138924308-138924330 ACATAAAATGATTTATCCTTAGG - Intronic
1033664216 7:143425350-143425372 AAATATGATATATTATACTGTGG - Intergenic
1035091982 7:156320268-156320290 ACATAAAAAAATTTATCCAGAGG + Intergenic
1035449842 7:158970057-158970079 ACAGAAATGAATTTATACTGAGG + Intergenic
1038382455 8:27109310-27109332 ACCTAAGATAACGTAAACTGAGG + Intergenic
1038867605 8:31456613-31456635 ATATAACCTAATTTATATTGGGG + Intergenic
1039332173 8:36550095-36550117 ACCAAAGATCATTTATACTAGGG + Intergenic
1039591622 8:38754826-38754848 ACTAAAGATAATTTATAAAGAGG + Intronic
1042458828 8:69038493-69038515 ATATAAGATAAGTAATAATGGGG - Intergenic
1042784133 8:72528002-72528024 ACATTAGATAATATATCTTGGGG - Intergenic
1042910912 8:73825275-73825297 ACTTAAGATAATAGAGACTGGGG + Intronic
1043079306 8:75745750-75745772 ACATTAGTTAATTAATACTTGGG + Intergenic
1043582089 8:81725805-81725827 AAATATGAGAATGTATACTGTGG - Intronic
1044197313 8:89393109-89393131 ATATAAGAAAAATTAGACTGGGG + Intergenic
1044280840 8:90354094-90354116 GAATAAGATAATTTATTCTGAGG - Intergenic
1044886269 8:96781723-96781745 ACATAACACAATTCATTCTGAGG + Intronic
1044902173 8:96958380-96958402 AAATGAGACAACTTATACTGTGG + Intronic
1047389119 8:124435893-124435915 TCACAAGAAAATTTATAATGCGG - Intergenic
1048906607 8:139095183-139095205 ACATAAGATAAATTTCACTTAGG + Intergenic
1049489131 8:142883923-142883945 ACATAATCTCACTTATACTGTGG - Intronic
1050846282 9:10224189-10224211 AAATAAGATAATTTATATAGTGG - Intronic
1051245220 9:15103336-15103358 ACATAAGCGAAGTTATTCTGAGG + Intergenic
1051876079 9:21795021-21795043 AAATAAAATTATTTATACTCAGG + Intergenic
1051984898 9:23072518-23072540 ACATAAGATAAATTATCATATGG + Intergenic
1052128913 9:24816271-24816293 ACATCTGTTAATTTATACAGAGG - Intergenic
1052801043 9:32968510-32968532 ACATAAGATACTTTATAAAAGGG + Intergenic
1052809867 9:33047985-33048007 AAACAACATATTTTATACTGAGG + Intronic
1052841265 9:33292896-33292918 ACATAAGATAATTTAAAGGTTGG - Intronic
1053584737 9:39445127-39445149 ACATCAGAGAATTCATACTGGGG - Intergenic
1054581581 9:66920095-66920117 ACATCAGAGAATTCATACTGGGG + Exonic
1056228624 9:84522173-84522195 ACTTAAAATAATTTATATTGAGG - Intergenic
1056804202 9:89715431-89715453 TCATTAGATAAATTAAACTGTGG + Intergenic
1057682166 9:97198806-97198828 ACATAAAAGAGTTCATACTGGGG - Intergenic
1058145673 9:101408347-101408369 ACATCAGAGAATTCACACTGGGG + Exonic
1059099699 9:111458475-111458497 ACATTTGATAACTTACACTGAGG + Intronic
1059266940 9:113042910-113042932 ACATCAGAGAACTCATACTGGGG - Exonic
1059474790 9:114537005-114537027 AAATAAGAGATTTTTTACTGGGG - Intergenic
1060238122 9:121880554-121880576 AGAAAAAATAATGTATACTGTGG - Intronic
1203485887 Un_GL000224v1:54213-54235 ACATCAGAGAACTCATACTGGGG + Intergenic
1186680891 X:11872675-11872697 ACTTAAAATCATTTATTCTGTGG + Intergenic
1187743059 X:22377052-22377074 AAATCAGATAATTTATATTATGG + Intergenic
1188074862 X:25762793-25762815 ACAGAATATAATTTAAACCGTGG + Intergenic
1190092120 X:47448212-47448234 ACATCAGAAAACTCATACTGGGG - Exonic
1192019708 X:67374476-67374498 ACATGAGAAAATTCATACTGGGG + Intergenic
1192767297 X:74154249-74154271 ACATAAAATAATTTATACCTAGG + Intergenic
1193192231 X:78584332-78584354 ACATAAGCTGTTTTATACTTTGG - Intergenic
1193519221 X:82508599-82508621 AAATAGAATAATTTATCCTGGGG + Intergenic
1193976916 X:88132267-88132289 ACATGAGATAATGCAGACTGTGG + Intergenic
1194272886 X:91840449-91840471 TCAAAAGATCATTTAAACTGGGG + Intronic
1194855436 X:98922033-98922055 ACAGAAAATGATTTATAATGTGG - Intergenic
1196149928 X:112362544-112362566 CCATAAGCTTATTCATACTGAGG - Intergenic
1196206472 X:112945922-112945944 ACCTAAGATTATATCTACTGTGG + Intergenic
1196640577 X:118055232-118055254 CCATAAGATGGTTTCTACTGTGG - Intronic
1198325704 X:135570478-135570500 ATATCAGATAATTTAGATTGTGG + Intronic
1200590129 Y:5061856-5061878 TCAAAAGATCATTTAAACTGGGG + Intronic
1200868319 Y:8069424-8069446 ATATAAGATAATTCACACCGGGG - Intergenic
1200893673 Y:8351513-8351535 TCATAAGAGAGTTCATACTGTGG + Intergenic