ID: 1164032331

View in Genome Browser
Species Human (GRCh38)
Location 19:21418804-21418826
Sequence CAGGAGCATGCTTTTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164032328_1164032331 14 Left 1164032328 19:21418767-21418789 CCAAAATAAAGGGATGGGTTGGG 0: 26
1: 39
2: 55
3: 254
4: 346
Right 1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG 0: 1
1: 0
2: 1
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164032331 Original CRISPR CAGGAGCATGCTTTTTTTTG TGG Intronic
900040301 1:456428-456450 TAGGAGCAATTTTTTTTTTGGGG - Intergenic
900672600 1:3865066-3865088 TAAGAGCATTTTTTTTTTTGCGG + Intronic
900910601 1:5594462-5594484 GAGGAGGATGCTTTTTTGAGTGG - Intergenic
901987151 1:13085231-13085253 CAGGAGGATTTTTTTTTTTAAGG - Intergenic
901994661 1:13141536-13141558 CAGGAGGATTTTTTTTTTTAAGG + Intergenic
902521802 1:17022386-17022408 CAGGAGCAGGCTTTATTTGTAGG - Intronic
902622546 1:17658952-17658974 CAGGAGAATGCTTGATTTGGTGG + Intronic
902826923 1:18981277-18981299 CAGGGCCATGCTTTCTTTGGAGG - Intergenic
903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG + Intergenic
905398609 1:37685174-37685196 CACTCGAATGCTTTTTTTTGGGG + Intronic
905493008 1:38360098-38360120 CAGGATCATGCTTCCTTCTGAGG + Intergenic
906625940 1:47325715-47325737 CAGGTGCATGCTTTGTCTTCAGG - Intergenic
906776442 1:48534119-48534141 CAGGAGCATGCATTTTCTGCTGG - Exonic
908381386 1:63599920-63599942 CAGGAGCATACAATCTTTTGGGG + Intronic
908424990 1:63998401-63998423 CAGAAGCATCCTTCTGTTTGAGG + Intronic
908531776 1:65040797-65040819 CAGGACTATGTTTTTTTTCGTGG - Intergenic
910109357 1:83666211-83666233 AAGAAGCTTCCTTTTTTTTGTGG + Intergenic
911234137 1:95391611-95391633 CAGGAGCTAGCTTCTTTTTCTGG + Intergenic
911986581 1:104633181-104633203 CATAAGCATGCTTCTTTTTTAGG + Intergenic
912424101 1:109571174-109571196 GAGGAGCAGGGTTTGTTTTGAGG + Intronic
915236235 1:154484995-154485017 GAGGAGGATGAGTTTTTTTGGGG - Intronic
916280682 1:163047974-163047996 CAGGAGAATTCTTTGTTGTGGGG + Intergenic
917694181 1:177503242-177503264 CAGGGACATGCTGTTTTGTGAGG - Intergenic
918366466 1:183813092-183813114 CAGGAGGAGGCTTTCTTTAGTGG + Intronic
919181863 1:194095737-194095759 CAAGTGCATGCTTATGTTTGGGG - Intergenic
921402768 1:214744433-214744455 CATAAGCATGCTTTTTTGTGGGG - Intergenic
921960583 1:221029662-221029684 CAAGAGCATGCTTTTCCTTCTGG - Intergenic
923432661 1:233938249-233938271 CAGCTGCAGGCTTTCTTTTGAGG - Intronic
923563219 1:235057475-235057497 CAGCAGCTAGCTTTCTTTTGGGG - Intergenic
1062788919 10:289022-289044 CAGGTGCATTATTTATTTTGAGG + Intronic
1062905852 10:1179208-1179230 AAGTCGCATGCTTTTTTTTTTGG - Exonic
1063491646 10:6469645-6469667 CAGGAGAGTGCTCTTTTCTGTGG - Intronic
1064027666 10:11861423-11861445 CAGGAGCATGATTTATACTGTGG + Intronic
1064085883 10:12346351-12346373 AAGAAGTATGCTTTTTCTTGAGG + Intergenic
1064576669 10:16752818-16752840 CAGGAGTAAGGTTTGTTTTGTGG - Intronic
1065246964 10:23768220-23768242 CAGGAGCATGGTCTCTTTTATGG + Intronic
1066090530 10:32014433-32014455 TCGGAGCCTGCTTTTTTTTCCGG - Intronic
1067145833 10:43693145-43693167 AAAGAGCATGTTTTTTTTTGTGG + Intergenic
1068026911 10:51657578-51657600 CATCAGCATTCTTTATTTTGTGG + Intronic
1070594641 10:77824070-77824092 CAGGAGAATGGCTTTATTTGGGG - Intronic
1072067441 10:91884573-91884595 CAGGAATATTCTTTCTTTTGTGG + Intergenic
1072381996 10:94882371-94882393 CAGGAACATGCTTTTAAATGTGG - Intergenic
1073932089 10:108587473-108587495 CAGTAGAATTCTTTTTTCTGAGG + Intergenic
1074244869 10:111679506-111679528 TGGGAGGGTGCTTTTTTTTGGGG - Intergenic
1074731487 10:116381214-116381236 TAGAACCATGCTTTCTTTTGTGG + Intergenic
1075299026 10:121304037-121304059 AAGGAGCAACCTTTTTTTTCGGG - Intergenic
1078040230 11:7854748-7854770 CAAGAACATGCATTTTTTTCAGG - Intergenic
1078497403 11:11833068-11833090 CAGAACCAATCTTTTTTTTGAGG + Intergenic
1078655166 11:13231911-13231933 CAGGTGCATGCATGCTTTTGTGG + Intergenic
1079471036 11:20777727-20777749 CAGGAGTTTGCTATATTTTGAGG + Intronic
1079880978 11:25925915-25925937 GAGGAGCTTTCTTTTTTATGAGG - Intergenic
1080689392 11:34543748-34543770 CAGGATCTTGTTCTTTTTTGTGG - Intergenic
1081094377 11:38915105-38915127 CATGAGCATGCATTTTTGTTAGG + Intergenic
1082264035 11:50100329-50100351 TAGGATCATCTTTTTTTTTGGGG - Intergenic
1084245950 11:67857108-67857130 CAGGAGCATGCTCCTTTCAGAGG - Intergenic
1084826726 11:71737398-71737420 CAGGAGCATGCTCCTTTCAGAGG + Intergenic
1085331416 11:75655070-75655092 CAGGAGATTGCTGTCTTTTGAGG - Intronic
1085485496 11:76860279-76860301 TAGCAGCATTCTTTTTTTTTAGG + Intergenic
1086300806 11:85424280-85424302 CAGGAGCAATCTTCTTTTTTCGG + Intronic
1089712929 11:120329837-120329859 CAGGCACATGCTTTTTAATGAGG - Intronic
1089982899 11:122787174-122787196 AAGGAACATTCTTTTTTTTCTGG - Intronic
1091560807 12:1611535-1611557 CAATAGCATGCATTTATTTGTGG + Intronic
1092508815 12:9131499-9131521 AATGAGCATCCTTGTTTTTGAGG + Intergenic
1094464889 12:30742424-30742446 CAGGAGTAAGATTTTTTTTCAGG - Intronic
1095212250 12:39507961-39507983 CAGAAGCATGTGGTTTTTTGGGG + Intergenic
1096476431 12:51912008-51912030 CAGGAGCCTGTTTATGTTTGAGG + Intronic
1097735069 12:63173439-63173461 CAGGAGCATTCTTTCCTGTGAGG - Intergenic
1098092236 12:66915993-66916015 CTGAAGCATGCTTTTGTTGGGGG + Intergenic
1101323361 12:103693290-103693312 TAGGTGCATGCTTTTTTTTTTGG - Intronic
1101460557 12:104888064-104888086 CATCAGCATGCTATTTTTTTAGG - Intronic
1103099756 12:118163429-118163451 CAGGGACATACTTTTTTTTTGGG + Intronic
1103244237 12:119441561-119441583 CAGGAGAGTGATTTTCTTTGGGG - Intronic
1107863022 13:44678713-44678735 CTGGAGTCTTCTTTTTTTTGTGG + Intergenic
1111903838 13:94232518-94232540 CAGGAGGTGGGTTTTTTTTGGGG + Intronic
1113412002 13:110098390-110098412 GAGGAGCATTCTCTTATTTGGGG - Intergenic
1115956784 14:38790153-38790175 AAACAGCATGCTTTTTTTTTTGG + Intergenic
1117675262 14:58149406-58149428 GGGGACCATGCTTTTCTTTGTGG - Intronic
1117962589 14:61177960-61177982 CAGGATGATTCTTTTTTGTGTGG + Intergenic
1119522995 14:75299881-75299903 CAGGAGCATGTATTTCTTTTGGG - Intergenic
1120551285 14:85876290-85876312 CAGAATCATGCATTGTTTTGAGG - Intergenic
1121132849 14:91464337-91464359 CTGTAACATGCTTTTTTTGGGGG - Intronic
1121599315 14:95191359-95191381 CCTGAGCATGCTTTTTTCTTTGG - Exonic
1123151410 14:106185302-106185324 CTGGAGCATCCTTTTCTTGGTGG - Intergenic
1123399812 15:19973185-19973207 CTGGAGCATCCTTTTCTTGGTGG - Intergenic
1123998858 15:25737902-25737924 CAGCAGGATGGTTTCTTTTGAGG - Intronic
1124397097 15:29311692-29311714 AAAGATCATACTTTTTTTTGGGG - Intronic
1124641296 15:31398150-31398172 CAGGAGCATCCTGTGCTTTGTGG - Intronic
1127226207 15:56932396-56932418 CAAGAGCATGGTTTGTCTTGAGG + Intronic
1127681925 15:61305856-61305878 GGGGAGCTTGCTATTTTTTGAGG + Intergenic
1129356982 15:74997825-74997847 CAGGAGACTGCTGTTTTCTGAGG + Intronic
1129864751 15:78897814-78897836 CAGGTGCGTGCTTTGTTTTCTGG + Exonic
1130192244 15:81748543-81748565 CAGGGCCATGCTCTTTTCTGAGG - Intergenic
1130402395 15:83569541-83569563 CAAGAGTATGCTTATTTTTCAGG + Intronic
1130914415 15:88293677-88293699 CAGGATCACTCTTTTTTTTTTGG - Intergenic
1131791694 15:95972544-95972566 CAGGAGCATGTGTTTCTTTGTGG - Intergenic
1137857909 16:51814964-51814986 CAGCTTCATGTTTTTTTTTGGGG + Intergenic
1139110110 16:63879866-63879888 CATGAGAAAACTTTTTTTTGTGG - Intergenic
1142863157 17:2775832-2775854 CAGGAGCATCCTTGGTTTGGCGG + Intergenic
1143706695 17:8703127-8703149 CAGGAGCAAGCTCTGTTTGGGGG + Intergenic
1143790634 17:9292578-9292600 CTCGAGCATGCTTTATTCTGAGG + Intronic
1145201048 17:20944943-20944965 CATGAAGATGCTTTTTTGTGTGG + Intergenic
1146642611 17:34552725-34552747 CGGAAGCATGCTTTTCTGTGTGG - Intergenic
1149073370 17:52570323-52570345 CAGAAGCATCCTTTTTTGGGGGG + Intergenic
1149472750 17:56932234-56932256 CAGGAGCCTTTTTTTTTTTTTGG + Intergenic
1150704908 17:67477844-67477866 CATGAGCAAGACTTTTTTTGGGG - Intronic
1153379768 18:4425325-4425347 CATGTTCATGCTTTTATTTGAGG + Intronic
1155098889 18:22589314-22589336 CAGGATAATGCTTACTTTTGGGG + Intergenic
1160440945 18:78892039-78892061 CAGGACCATGCTGTTCTCTGAGG + Intergenic
1160597104 18:79983372-79983394 CATAAGCATGCTTTTTCTTTAGG + Intronic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG + Intronic
1164082221 19:21868331-21868353 CAGGAACCTGTTTTTTTTTTTGG + Intergenic
1164142216 19:22482365-22482387 AAGGAACATTTTTTTTTTTGTGG + Intronic
1164430882 19:28187753-28187775 CAGGTCCATGCTTTATTTTGTGG - Intergenic
928241943 2:29594105-29594127 CAGGATAATTCTTTGTTTTGGGG - Intronic
930384422 2:50675727-50675749 CAGGGGCATGCTATTCTTTGAGG + Intronic
930850450 2:55955105-55955127 CAGCAGCATTCTTATTTTTGTGG - Intergenic
931234850 2:60404443-60404465 CAGGAGAATTCTTTGTTGTGGGG - Intergenic
931426542 2:62177029-62177051 AAGGAGCATGCTTGATTTGGGGG + Intergenic
931831833 2:66060740-66060762 TAGAAGAAAGCTTTTTTTTGCGG - Intergenic
933311147 2:80662794-80662816 CAGGTGTATGTTTTTTTCTGTGG - Intergenic
933505521 2:83172686-83172708 AACGAGCCTGCTTTTTTCTGTGG + Intergenic
936145432 2:109977706-109977728 CAGGAGCTTCTTTTTTTCTGAGG + Intergenic
936199254 2:110393772-110393794 CAGGAGCTTCTTTTTTTCTGAGG - Intergenic
936573615 2:113635781-113635803 AAGGAGCATGTTTTTCTTTTGGG + Intronic
936908444 2:117565016-117565038 CATGATCTTGCTCTTTTTTGTGG + Intergenic
937013680 2:118584091-118584113 CCGGAGCAGGCTTTTGGTTGAGG + Intergenic
939296904 2:140277885-140277907 CATGTGCATGCTTTTCTTTTGGG - Intronic
940128610 2:150355797-150355819 AGGGAGCATGCTTGATTTTGTGG - Intergenic
940336659 2:152535967-152535989 AATGAGCATGCATTCTTTTGGGG + Intronic
945416305 2:209577204-209577226 AAGGGGCATTTTTTTTTTTGCGG + Intronic
946378203 2:219327066-219327088 CTGGACCCTGCTGTTTTTTGAGG - Intergenic
946513844 2:220389908-220389930 CAGGAGCTTTCTCTTTTCTGGGG + Intergenic
947505375 2:230704432-230704454 CAGGAAGGTGCTTTTTTGTGGGG + Intergenic
1169050251 20:2570514-2570536 CATGAGCATGGATTTTTTTTTGG - Intronic
1169180905 20:3565993-3566015 CAAGAGCATGCTTTTTGGTGTGG + Intronic
1170397033 20:15937365-15937387 CAGGCTCATGCTTTCTTTGGTGG + Intronic
1170488178 20:16841853-16841875 CAGGAGCTTGCTTTGTTTGCTGG + Intergenic
1171365615 20:24621574-24621596 CAGTGGCATCCTTTTTTTGGGGG + Intronic
1172310767 20:33916552-33916574 CAGGATAATGGTTATTTTTGAGG - Intergenic
1172562427 20:35901123-35901145 CCTAAGCATGCTTTTTATTGAGG - Intronic
1172619264 20:36308327-36308349 CAGGAGCCTCTTTTTTGTTGGGG + Intronic
1172951478 20:38725704-38725726 CAGGTATATGCTTTTGTTTGTGG - Intronic
1173174705 20:40755535-40755557 CAGGAGCATGCATTTTTGGTGGG - Intergenic
1174040019 20:47692878-47692900 CAGAAACATTCTATTTTTTGTGG + Intronic
1177049985 21:16220985-16221007 CAGGTTCATGTTCTTTTTTGAGG + Intergenic
1178614707 21:34122034-34122056 CAGGCTCATGGTTTTATTTGTGG + Intronic
1180297314 22:10954142-10954164 TAGGAACATGCTTATTTTTACGG + Intergenic
1180914178 22:19473886-19473908 CAGGTTCATGCTTGGTTTTGGGG - Intronic
1182979501 22:34655270-34655292 CAAGAGCCTGTTTTATTTTGGGG - Intergenic
1185066330 22:48633363-48633385 CAGGAGCATGGGTGTGTTTGTGG + Intronic
1185103934 22:48856629-48856651 CAGGAGCAGGCGTTTGTCTGGGG + Intergenic
1185426563 22:50775100-50775122 AAGGAGCATGTTTTTCTTTTGGG - Intronic
949430722 3:3972710-3972732 AAGGATCTTGCTTTTTGTTGGGG - Intronic
953116018 3:39993221-39993243 CAGGAGCAGGCTCATTATTGTGG - Intronic
955339917 3:58117359-58117381 CAAGAGCATACTTTCTTTTATGG + Intronic
956167052 3:66405067-66405089 GAGGAGCTGGCTTTTGTTTGGGG - Intronic
956500184 3:69874380-69874402 CATGAGCATGCTTCTTCTTTTGG - Intronic
957173721 3:76776154-76776176 AATGTGCATGCTTTTCTTTGGGG - Intronic
958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG + Intergenic
959305940 3:104666156-104666178 CAGGTGCATGGTTTTTTTCCAGG - Intergenic
959895023 3:111595530-111595552 CAGGAACATCCTTTTCTTGGTGG - Intronic
961894073 3:130152837-130152859 CAGGAGCATGCTCCTTTCAGAGG - Intergenic
963605557 3:147409731-147409753 CAGGAGGAAGTTTTTTTTTAGGG + Exonic
964199836 3:154106662-154106684 CTGAACCAGGCTTTTTTTTGTGG - Intergenic
965110973 3:164421675-164421697 CAGGAGAATGGTTATTTTTGGGG - Intergenic
965391132 3:168105727-168105749 CAGTAACAGGCTTTTTTTGGGGG - Intergenic
965725552 3:171711515-171711537 CATGAGTATCCTTTTTTTTCTGG - Intronic
966745434 3:183270690-183270712 CAGGACCATGTGTTTTTTTCTGG + Exonic
967465862 3:189805681-189805703 AAGGAGCATGGCTTATTTTGAGG + Intronic
967465868 3:189805727-189805749 AAGGAGCATGGCTTATTTTGAGG + Intronic
967526984 3:190506337-190506359 AAGGAGTATTCTTTTTTTTGAGG - Intergenic
969206309 4:5649197-5649219 CAGGAACATTTGTTTTTTTGAGG + Intronic
970098101 4:12487635-12487657 CACGAGGGTGCTTTTTTGTGTGG + Intergenic
970146227 4:13038863-13038885 CAGGGACCTGCTTTTTTTTGTGG - Intergenic
970888942 4:21020048-21020070 CAGAAGCATGCTTTATTTAAAGG - Intronic
971011579 4:22442972-22442994 CAGTAGCATGCTGATTATTGAGG - Intronic
971843610 4:31889559-31889581 TAGGAGCATTTTTTTTTTTTAGG - Intergenic
973252421 4:48074480-48074502 CATGTGCATGTTTTTTTGTGGGG + Intronic
973257057 4:48124168-48124190 CAGGATCATTCTTTATTGTGGGG + Intronic
973999487 4:56496991-56497013 TGGGAGCATGCTTTTTTTTGGGG - Intronic
977718525 4:100211226-100211248 AAGGAGCATGTTTATTTATGGGG - Intergenic
979171452 4:117604414-117604436 AAGGAGCATTCTTTTTTGGGGGG + Intergenic
979455185 4:120919274-120919296 AAGGAGCTTGCTTTCTTATGTGG - Intronic
981029139 4:140106442-140106464 CAGAAGCATGCATTTGTGTGTGG + Intronic
981080486 4:140634992-140635014 CTAGCGCATGCTTTTTTGTGTGG - Intronic
981875076 4:149532478-149532500 GAGGAGCATGCTTTTTCTGAAGG + Intergenic
982506428 4:156223882-156223904 CAGGAAACTGATTTTTTTTGTGG + Intergenic
982915435 4:161203117-161203139 CTGGTGCATGCTTTTTATTCAGG + Intergenic
984588327 4:181588075-181588097 CAGGGGCATGCGCTTTTTAGAGG + Intergenic
984835548 4:184016592-184016614 CTTGAGCATGCCCTTTTTTGGGG - Intronic
986050162 5:4082861-4082883 CAGTAGCATGATTTTTTCTTTGG - Intergenic
986974087 5:13375249-13375271 CATGAACATGCTTCTTTATGTGG - Intergenic
987979018 5:25055689-25055711 TAGGAGCATGATTTTTCTTGTGG - Intergenic
988077477 5:26371285-26371307 CAGGATCATGCTTTCCTTTATGG - Intergenic
989409023 5:41095956-41095978 CCGGGGCAGGCTGTTTTTTGGGG + Intergenic
992625679 5:78634116-78634138 CAGAAATATGCTTTTTTTGGGGG - Intronic
993017525 5:82551796-82551818 CAGGATAATGCTTATTTTTGTGG + Intergenic
993248118 5:85478308-85478330 CAGGAGTATTGTTTTATTTGGGG - Intergenic
993451671 5:88078704-88078726 CAGGAACTTGTTCTTTTTTGTGG - Intergenic
993880659 5:93356773-93356795 CAGGAACAGACTTTTTTTTGGGG - Intergenic
995449724 5:112287270-112287292 CAGGAGAACAATTTTTTTTGAGG - Intronic
995623983 5:114056646-114056668 CAGGAGAATGTTTCTTTTTAAGG - Intergenic
995744209 5:115386892-115386914 CAGGACCATGCCGTTTATTGAGG - Intergenic
995779236 5:115758308-115758330 CTGTAGCAAGCTTTTTTTTTTGG - Intergenic
996167169 5:120238432-120238454 CAGGAGCTTGGTTTCTTGTGTGG + Intergenic
997740720 5:136251459-136251481 CAGGACCAAGGGTTTTTTTGAGG + Intronic
1004044034 6:12009459-12009481 CAGGAGCCCCCTCTTTTTTGGGG + Intronic
1004259857 6:14098299-14098321 CTTGAGTATTCTTTTTTTTGGGG - Intergenic
1005147794 6:22711406-22711428 CAGGAACATTTTTATTTTTGAGG - Intergenic
1009978854 6:70702370-70702392 CAGTTACATGCTTTTTTTTTGGG + Intronic
1010266309 6:73872083-73872105 CAGGTGAATTCTTTGTTTTGTGG + Intergenic
1010453069 6:76025489-76025511 CGTAAGCATCCTTTTTTTTGTGG + Intronic
1010840022 6:80638163-80638185 CAGAATCATGCTTTGATTTGGGG + Intergenic
1011562771 6:88639535-88639557 CAGGAGCATTCCTTTTTATTTGG - Intronic
1012809426 6:103938852-103938874 CAAGAACATTTTTTTTTTTGGGG + Intergenic
1016384403 6:143516432-143516454 CAGGAGCATGCTGTCTGCTGAGG + Intergenic
1017021745 6:150145070-150145092 CACCAGCATGGTTCTTTTTGTGG + Intronic
1018686963 6:166310548-166310570 TAGGAGCATGCTTTGCTCTGAGG - Intergenic
1018983230 6:168615770-168615792 CAGGAGCATCTTTTTTCTTGGGG + Intronic
1019636797 7:2080421-2080443 CAGGAGCTTGCTCTCTTGTGGGG - Intronic
1020599619 7:10256013-10256035 CAGGAGCATGAATTTTAGTGGGG - Intergenic
1020943007 7:14563865-14563887 CAGCAGCTTGCTTTTCTCTGAGG - Intronic
1022148895 7:27578001-27578023 GAGGAGTAAGGTTTTTTTTGAGG - Intronic
1023393073 7:39729078-39729100 CAAGAGAATACTTTTTTTTCCGG + Intergenic
1023461017 7:40397201-40397223 AAGGAGCATGCATTTTTCTGTGG + Intronic
1027427031 7:78071542-78071564 CAGGGGCTTTCTTTTTTTTCTGG - Intronic
1030312962 7:108086357-108086379 CAGGTGCATGTGTTTTATTGAGG - Intronic
1030655787 7:112166267-112166289 CAAGAGCATGTTTTTTCTTTTGG - Intronic
1030679929 7:112424054-112424076 AAGGATAATGCTTTTCTTTGGGG + Intronic
1031415797 7:121495271-121495293 AAGGAGAATGCTTTTTGGTGAGG + Intergenic
1031766273 7:125781513-125781535 CAGGAGCTTGGGGTTTTTTGGGG + Intergenic
1032067296 7:128781222-128781244 CAGGATCATTCTTCTTTGTGTGG - Intergenic
1032698595 7:134359143-134359165 CAGAAAAGTGCTTTTTTTTGTGG + Intergenic
1036189442 8:6656893-6656915 CAGGAGTTTGCTTTTCTTTAGGG - Intergenic
1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG + Intergenic
1037188273 8:16091317-16091339 CAGCAGTTTGCTTTTTTTTTTGG + Intergenic
1038500275 8:28037909-28037931 CCGGATCATGCTTTGTTGTGAGG - Intronic
1042017967 8:64338125-64338147 CAGCAGCATTCTTTTTTGAGTGG - Intergenic
1043180782 8:77083916-77083938 CAGGAGCATGCTGTGTTCTGGGG - Intergenic
1043523547 8:81072398-81072420 CTGGAGAATTCTTTGTTTTGAGG + Intronic
1044997681 8:97852683-97852705 AAGGAGTAGGCTTTTTTTTGGGG + Exonic
1045655707 8:104384143-104384165 CAGGAGGCTGCTTGTTTCTGAGG - Intronic
1045815978 8:106276636-106276658 CAAGAGCATGCTTATTTTCTTGG + Intronic
1047138509 8:122108066-122108088 TATGAGGATGCTTTTTTGTGTGG + Intergenic
1047679793 8:127242926-127242948 TAGAAGCATGCTTGTTTTTCAGG + Intergenic
1050140174 9:2509772-2509794 CAGGAACTGGCTTTCTTTTGTGG - Intergenic
1050670047 9:7985912-7985934 CAGGAGGGTGCTTATTTTAGGGG - Intergenic
1051229246 9:14937177-14937199 GTGCAGCATGCTTTTCTTTGTGG + Intergenic
1052943280 9:34147197-34147219 TAGGAGAGAGCTTTTTTTTGGGG - Intergenic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1056734458 9:89195481-89195503 CAGGATTTTACTTTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057434122 9:95023610-95023632 CACCAGCAAGCATTTTTTTGTGG - Intronic
1060887264 9:127163209-127163231 CTAGAGGATGCTTTTTGTTGTGG + Intronic
1061326098 9:129865651-129865673 GAGGGGAATTCTTTTTTTTGTGG + Intronic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1186100063 X:6146375-6146397 CAGGGACAGGCTATTTTTTGAGG - Intronic
1188379227 X:29471024-29471046 CAGGTGCATGGTTTGTTTTGGGG - Intronic
1190447690 X:50546040-50546062 CAGGAGGTGGCTTATTTTTGGGG - Intergenic
1193602085 X:83519820-83519842 CAGGAGCATGCTTATCTTAGGGG + Intergenic
1195200978 X:102549896-102549918 GAGAAGCAAGGTTTTTTTTGGGG - Intergenic
1196174115 X:112621614-112621636 CAGGAGAGTGGTTATTTTTGAGG - Intergenic
1196916827 X:120545487-120545509 CAGGAGCATTTTTTTGTTTCTGG - Exonic
1198769233 X:140110942-140110964 CAGGAGGATATTTTTTCTTGGGG - Intergenic
1199398844 X:147373188-147373210 CTGGTCCATGCTTTTTTTTCTGG + Intergenic
1201594336 Y:15651005-15651027 CAGGAGTCTCCTTCTTTTTGAGG + Intergenic
1202064547 Y:20924884-20924906 GAGGAGCATCATTCTTTTTGAGG + Intergenic
1202571003 Y:26270368-26270390 CAAGAGTCTTCTTTTTTTTGGGG + Intergenic