ID: 1164032981

View in Genome Browser
Species Human (GRCh38)
Location 19:21426643-21426665
Sequence TCTTGCAAATGTAATAAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 3, 1: 0, 2: 11, 3: 54, 4: 496}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164032981 Original CRISPR TCTTGCAAATGTAATAAATT TGG Exonic
901269295 1:7938973-7938995 TCTTGCAAATGTATTGTTTTAGG - Intronic
904086154 1:27909894-27909916 TATTGCAAATGTAAAGAATGAGG - Intronic
904393611 1:30202783-30202805 TCTAGAAAAAGTAAAAAATTAGG - Intergenic
904874426 1:33643315-33643337 TTTTGCACATGTAATAAGTGTGG - Intronic
906443346 1:45871050-45871072 TCTTGCAAATGGCATACAGTAGG + Intronic
907552798 1:55318626-55318648 CCTTGCAACTGTGAGAAATTGGG - Intergenic
907618354 1:55948531-55948553 TCTTGCGCATATAATAAAATAGG + Intergenic
907871210 1:58445159-58445181 TCTGACAAATGTAAAAAATGGGG - Intronic
909129558 1:71717153-71717175 TCTTACAAATGTAACATAATAGG - Intronic
909922211 1:81396351-81396373 TCTTGCAACTTTACTAAATTTGG + Intronic
910083236 1:83367626-83367648 TCTTGCATTTGTAAAAAATTTGG + Intergenic
910653521 1:89596145-89596167 TCTTCTAAATGTCATAACTTAGG - Exonic
910968784 1:92833105-92833127 CCTGTTAAATGTAATAAATTGGG + Intronic
911325680 1:96468899-96468921 TATTGCAAATGTAAACAATCTGG - Intergenic
911355923 1:96820384-96820406 TCTAGCATATTTAATATATTAGG + Intronic
912089782 1:106056842-106056864 CCTTTCAAATTTAATTAATTTGG - Intergenic
912231067 1:107793394-107793416 TATTTCAAATGTCAGAAATTAGG - Intronic
912377643 1:109224576-109224598 TCTTTTAAATGTAGAAAATTTGG + Intronic
912454815 1:109790254-109790276 TCTTTCAAGTATAGTAAATTAGG + Intergenic
912641864 1:111353878-111353900 TCTGTCATATGTAATATATTTGG + Intergenic
916339537 1:163714259-163714281 TTTTGCACATTTAAAAAATTAGG + Intergenic
917819845 1:178751384-178751406 TCTAGCAAATGAAACAAATAGGG + Intronic
918301892 1:183212165-183212187 AGTTGAAAGTGTAATAAATTTGG + Intronic
919089279 1:192958347-192958369 TTTTGCAAATGTAACATACTTGG - Intergenic
920134151 1:203755888-203755910 TCTTGCACAAGAAATAATTTGGG + Intergenic
922691729 1:227697940-227697962 TCTTGTAAATCTAATAAATGTGG - Intergenic
923604447 1:235430509-235430531 TGTTGTAAATGTTAAAAATTAGG + Intronic
923726992 1:236514951-236514973 TCTTTTAAATGTATTAAATGGGG - Intergenic
924487413 1:244499187-244499209 TCATGCAAATGTATTTAGTTAGG - Intronic
924764246 1:247016979-247017001 CCCTACAAATGTAATAATTTTGG + Intergenic
924785207 1:247189949-247189971 TCCTACAAATGTAAAAAATGTGG - Intergenic
1064008935 10:11719850-11719872 TCTTGCAAAAGAAATAAACCTGG + Intergenic
1064802032 10:19087286-19087308 TCTGTTAAATGTGATAAATTGGG + Intronic
1065313511 10:24439491-24439513 TGTTGCTGCTGTAATAAATTAGG + Intronic
1065691493 10:28338559-28338581 TCCTGCAAATGTAAGTAATTTGG - Intergenic
1066665294 10:37777019-37777041 TTTGGCATATGTAAAAAATTTGG - Intronic
1066693446 10:38056282-38056304 TCTTGTCAATGTAATGAATGTGG + Exonic
1067291035 10:44940922-44940944 TCTATCAAAAGTAACAAATTAGG - Intergenic
1069267729 10:66483705-66483727 TCTTGCATATGTTATAGATCAGG + Intronic
1069635295 10:69921365-69921387 CATTGCAAATGTAATGAGTTAGG - Intronic
1070687942 10:78503616-78503638 TCTTGCAAATGTTCTAGCTTTGG - Intergenic
1070874220 10:79786792-79786814 TCTTGGAAATGTTATGAGTTAGG - Intergenic
1071641150 10:87308933-87308955 TCTTGGAAATGTTATGAGTTAGG - Intergenic
1072398048 10:95065686-95065708 TCTTCCAAATTTAATTCATTTGG + Intronic
1072873589 10:99147866-99147888 TCTTGGAAATCTAAAAACTTAGG + Intronic
1072985459 10:100135791-100135813 TATTGCAAATGTAATTTGTTTGG - Intergenic
1073550054 10:104391116-104391138 TCTTGTAAGTGCAATAATTTGGG + Intronic
1073963512 10:108961429-108961451 CCCTGTAAATGTAATAAATAGGG - Intergenic
1073976601 10:109108922-109108944 TCTGGCTAATGTAATTAATTGGG + Intergenic
1074223339 10:111459893-111459915 CCTTGGAAAAGTAATATATTAGG + Intergenic
1075962149 10:126577845-126577867 TATTGCATTTGTCATAAATTAGG - Intronic
1077359777 11:2135757-2135779 TCTTGCAAATGGAAGGAACTGGG - Intronic
1078299282 11:10109123-10109145 TTTTGCATATGTATTTAATTTGG - Intronic
1079659920 11:23023967-23023989 TATTTGAAATTTAATAAATTAGG + Intergenic
1079659958 11:23024482-23024504 TATTGAAAATTTAATAAATTAGG - Intergenic
1080145103 11:28972723-28972745 TACTGGAAATGTAATAAAATAGG - Intergenic
1081093518 11:38901739-38901761 TCTTTCAAATGTAATAACCAAGG + Intergenic
1082959971 11:58909392-58909414 TATTACAAAAGTAATAAATGAGG + Intronic
1084193622 11:67510578-67510600 TCTTGCACAAGAAATAATTTAGG + Intergenic
1085355540 11:75833338-75833360 GCTTGCAAATGTAGCAAAATGGG - Intronic
1085940916 11:81205855-81205877 TCTTCTAAATGTAAAAAATGAGG + Intergenic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1087246433 11:95843678-95843700 TTTTGCAAATTTAATGAGTTTGG - Intronic
1087816799 11:102666705-102666727 TGTTGGAAATGTAACTAATTTGG - Intergenic
1088055542 11:105571921-105571943 TCTGGCACTTTTAATAAATTTGG - Intergenic
1090201439 11:124860649-124860671 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090750497 11:129742785-129742807 ATTTGCAAATGTCATAAACTGGG - Intergenic
1090961677 11:131562844-131562866 CCTTGCAAATGAAAATAATTTGG + Intronic
1091423028 12:359893-359915 TCTTTCAGATGTATTGAATTTGG + Intronic
1092317527 12:7433680-7433702 TCTTGCAGATGGAACAGATTTGG - Exonic
1092677163 12:10933051-10933073 TCTTGAAAATCCAATAAAATTGG + Intronic
1092767116 12:11862708-11862730 CCTTGCAGATGTAATTAGTTAGG - Intronic
1095568612 12:43655879-43655901 TATTCCAAATGAAATAAAATAGG + Intergenic
1095629787 12:44362131-44362153 TTTTGCAAAGGAAATAAACTAGG - Intronic
1095916957 12:47489310-47489332 TCTTGAAAATGTTATGAGTTTGG + Intergenic
1097296440 12:57968630-57968652 CCCGGCAAATGTAATAAATTTGG + Intergenic
1097877351 12:64655723-64655745 TCTTAAAAATATCATAAATTTGG + Intronic
1098433998 12:70449887-70449909 GCTTTCAGATGTAATAAATAAGG - Intergenic
1098901397 12:76115431-76115453 GTTTGCAAATGCAATGAATTGGG - Intergenic
1099404241 12:82240631-82240653 ACGTGGAAAGGTAATAAATTGGG - Intronic
1099600440 12:84729091-84729113 CCTTTCAAAATTAATAAATTTGG + Intergenic
1099615163 12:84924939-84924961 ACTTTCAAATTTATTAAATTTGG + Intergenic
1100145178 12:91668896-91668918 TCTTCCAAATGTCATATAGTCGG + Intergenic
1100403530 12:94252640-94252662 TCTTGAAAATGTGAAAGATTTGG + Intronic
1102732793 12:115127893-115127915 TCTTGTAAATGCAATATAGTTGG + Intergenic
1103108665 12:118254591-118254613 TCTTGCAAAAGTAATACTTAAGG + Intronic
1104186674 12:126439453-126439475 TTTTCCAAAGGTATTAAATTAGG + Intergenic
1104207517 12:126654118-126654140 TTTTCCAAATGTCTTAAATTGGG - Intergenic
1105228736 13:18467218-18467240 CCATACAAATGTAATAAATGTGG - Intergenic
1105326494 13:19374925-19374947 TCCTGCAAATGTAATCCATGTGG + Intergenic
1107404636 13:40101131-40101153 ACAGGCAAATGTCATAAATTGGG - Intergenic
1107608108 13:42082495-42082517 TCTTGGAAATGTATTAACTCTGG - Intronic
1107627646 13:42306210-42306232 TCATGAATAGGTAATAAATTAGG + Intronic
1108192225 13:47953480-47953502 CCTTGCAAAATTAATAAATATGG + Intronic
1108402183 13:50057109-50057131 TCCTGTAAATGTTATATATTTGG - Intergenic
1109674502 13:65657265-65657287 TCTTGCAGATGTTAAAAACTGGG + Intergenic
1109922797 13:69091103-69091125 TCTTGGTAATGGAATAAATGAGG + Intergenic
1109998365 13:70160486-70160508 TCTTTCAACGGTAATTAATTTGG + Intergenic
1110266939 13:73549213-73549235 TCATGCAAATATGATAAAGTAGG - Intergenic
1110355485 13:74562107-74562129 AATTGCAGATGTAATTAATTGGG - Intergenic
1112244094 13:97713326-97713348 TCTTCCAAATGTAAGGAATCTGG + Intergenic
1112962687 13:105146641-105146663 TCTTGCAAACAGAAGAAATTTGG - Intergenic
1114013015 14:18394082-18394104 CCATACAAATGTAATAAATGTGG - Intergenic
1114053716 14:18946657-18946679 TCTTGAAAATCAAGTAAATTTGG - Intergenic
1114108841 14:19455268-19455290 TCTTGAAAATCAAGTAAATTTGG + Intergenic
1114708545 14:24753034-24753056 TCCTTCAAAGGTAATAAATGAGG - Intergenic
1114792112 14:25671313-25671335 ACTTGAAAATGCACTAAATTGGG - Intergenic
1114838019 14:26226953-26226975 TAAAGCAGATGTAATAAATTTGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116159469 14:41250723-41250745 TGTTGCCAATTTAATATATTTGG + Intergenic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1116617818 14:47161035-47161057 TCTTGTAATTCTAATAAAATAGG - Intronic
1116959842 14:50957710-50957732 TGATGAAAATGTAAGAAATTTGG - Intergenic
1117006317 14:51424720-51424742 TCTTGCAGATGTAAAAAAGTTGG + Intergenic
1117296991 14:54389485-54389507 TATTCCAAATTTAAGAAATTAGG - Intergenic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118389756 14:65286315-65286337 TCTTGTACATTTAAAAAATTTGG - Intergenic
1119225133 14:72939635-72939657 TCTTGCAAATACAACAAAATAGG - Intronic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1119841542 14:77797098-77797120 TCTTGTAAAAGTTATAATTTTGG + Intergenic
1120083650 14:80244041-80244063 TCCTAGAAATGTAATATATTTGG - Intronic
1120500595 14:85292673-85292695 TCATGCATATGTTATAAATAAGG - Intergenic
1120615515 14:86699221-86699243 TCAGGAAAATGTAATAATTTTGG - Intergenic
1121228718 14:92340800-92340822 TCTAAAAAATGTAATAAACTGGG - Intronic
1121893093 14:97616379-97616401 TCTTGCAAATAGAATATAGTTGG - Intergenic
1123506792 15:20949531-20949553 TATTGCACATGTAGTAAAATGGG + Intergenic
1123564017 15:21523276-21523298 TATTGCACATGTAGTAAAATGGG + Intergenic
1123600271 15:21960560-21960582 TATTGCACATGTAGTAAAATGGG + Intergenic
1126254251 15:46606521-46606543 CCATACAAATGTAATAAATCCGG + Intergenic
1126754766 15:51915028-51915050 TCTTACGAATGTAATAATTTGGG - Exonic
1128685039 15:69677814-69677836 TCTTGAGAATGTACTATATTGGG + Intergenic
1129533121 15:76285523-76285545 TTTTTCAAATGTAAGAAGTTGGG - Intronic
1129560898 15:76566640-76566662 TCTTACCATTGTATTAAATTTGG - Intronic
1130609295 15:85346336-85346358 TCCTGCAATTGTAATTAATTGGG - Intergenic
1202972378 15_KI270727v1_random:250371-250393 TATTGCACATGTAGTAAAATGGG + Intergenic
1133851476 16:9508334-9508356 TCTTGCAAGGGGAAGAAATTGGG - Intergenic
1138321362 16:56115735-56115757 ACTTGCAAATGAGATAAATTAGG + Intergenic
1138757177 16:59502567-59502589 CCTTGCTAATGTAATATACTTGG - Intergenic
1140313911 16:73874626-73874648 AATAGCAAATGTAAAAAATTAGG - Intergenic
1141292342 16:82730823-82730845 TCATGAAAATGTAACAAATCTGG - Intronic
1147546177 17:41403372-41403394 TCTGGCAATTTTAATAAACTAGG - Intergenic
1147798012 17:43059684-43059706 ACTTGCTAATGGATTAAATTTGG - Intronic
1149046357 17:52250508-52250530 TCTTACAAATATAATAAAAAGGG + Intergenic
1149073014 17:52565737-52565759 TTTTAAAAATTTAATAAATTTGG + Intergenic
1149182357 17:53954497-53954519 TCTTACAGATGTAATGAATGTGG + Intergenic
1149182396 17:53955250-53955272 TCTTACAAATGTCATACATATGG + Intergenic
1150946915 17:69757487-69757509 AATTGCAAAATTAATAAATTTGG - Intergenic
1151045236 17:70912026-70912048 TCTTTAAAATAGAATAAATTAGG + Intergenic
1151327308 17:73387264-73387286 TTTTTTAAATGTAGTAAATTAGG + Intronic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1153598667 18:6756447-6756469 TCTTCCAAACCTAATAAATGTGG + Intronic
1154314132 18:13290610-13290632 TCTTGCACATGTAAAAAATTAGG + Intronic
1154524727 18:15273080-15273102 CCATACAAATGTAATAAATGTGG + Intergenic
1155781425 18:29841412-29841434 TCTTGCTAATGTAAAAACTATGG + Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156917409 18:42478037-42478059 TTTTGCAAATGAAAAAAACTAGG - Intergenic
1156948577 18:42865495-42865517 TCTAGAAAGTATAATAAATTTGG - Intronic
1156979446 18:43267090-43267112 TCTTGCAAATGGAATAAAACTGG - Intergenic
1157006731 18:43591226-43591248 TATGGCAAATGTATTAGATTAGG - Intergenic
1157128424 18:44979871-44979893 TTTTGTAAATGTATTAAATGAGG - Intronic
1158736415 18:60086985-60087007 TCTTGACACTGTAATACATTAGG - Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159632081 18:70760724-70760746 TCTTTCAAATTTAAAACATTAGG - Intergenic
1159787921 18:72737558-72737580 ACTTTCAACTGTGATAAATTGGG - Intergenic
1160574886 18:79847662-79847684 TTTTTCAAATGTAATCAATAAGG - Intergenic
1161090736 19:2358790-2358812 TCTGCCAAAGGTAATAAAATGGG + Intergenic
1162607619 19:11722902-11722924 TCGTGCAAATGAAATAAACTGGG + Exonic
1162672951 19:12273608-12273630 TCATGCATACGTAATAAACTGGG + Exonic
1162678464 19:12319378-12319400 TCATGCATACGTAATAAACTGGG + Exonic
1162686666 19:12391751-12391773 TCATGCATATGTAATAAACTGGG + Exonic
1162691017 19:12431525-12431547 TCATGCATATGTAATAAACTGGG + Exonic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163902782 19:20120488-20120510 TCCTGCAAATGTAGTGAATTTGG + Intronic
1163911586 19:20199400-20199422 TCCTGCAAATGTAATGAGTTTGG + Exonic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009155 19:21182910-21182932 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164019999 19:21293184-21293206 TCCTACAAATGTGATAAATGTGG - Exonic
1164028980 19:21383153-21383175 CCTTTCAAATGTAAAAAATGTGG + Intergenic
1164029393 19:21387900-21387922 TCTTGCAGATATAATAAATGTGG + Intergenic
1164032746 19:21423200-21423222 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164045783 19:21539030-21539052 TCCAGCAAGTGTAATAAATTTGG + Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164092373 19:21969602-21969624 CCCTGCAAATTTAATAAATTTGG - Intronic
1164103994 19:22088264-22088286 ACTTGCAAATGTAAAGAATGTGG + Exonic
1164108233 19:22128784-22128806 CCCTGCAAATTTAATGAATTTGG - Intergenic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164184933 19:22857405-22857427 TCTTTCAAATGTAAAGAATGTGG + Intergenic
1164196805 19:22974563-22974585 CCCTGCAAATTTAATGAATTTGG - Intergenic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164264155 19:23596408-23596430 TCTTTCAAATGTAAATAATGTGG + Intronic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287454 19:23831964-23831986 TCCTACAAATGTAAAAAATGTGG + Intergenic
1164287596 19:23833933-23833955 CCCTGCAAATATAATAAATTTGG + Intergenic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1164987548 19:32659605-32659627 TCTTGAGAATGTCATAATTTTGG - Intronic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1165643688 19:37413915-37413937 TCTTACAAATGTAATGAATGTGG - Exonic
1167835269 19:52063196-52063218 CCTTGCAAATGTAATTAACGTGG - Intronic
1167835329 19:52063671-52063693 TCTTACAAATGTAACGAATGTGG - Intronic
1167835542 19:52065570-52065592 CCTTACAAATGTAATGAATGTGG - Exonic
1167835612 19:52066326-52066348 CCTTACAAATGTAATGAATGTGG - Exonic
1167835625 19:52066494-52066516 CCTTACAAATGTAATGAATGTGG - Exonic
1167840444 19:52113299-52113321 ACTTGGAAATGTAATCAATGTGG - Exonic
1167840676 19:52115836-52115858 ACTTACAAATGCAATAAATGTGG - Exonic
1167840679 19:52115920-52115942 CCTTGCAAATGCAATGAATGTGG - Exonic
1167845009 19:52155164-52155186 CCTTACAAATGTAATGAATGTGG - Exonic
1167845021 19:52155332-52155354 CCTTACAAATGTAATGAATGTGG - Exonic
1167845094 19:52156172-52156194 CCTTACAAATGTGATAAATGTGG - Exonic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167865416 19:52322190-52322212 CCTTACAAATGTAATGAATGTGG + Exonic
1167865428 19:52322358-52322380 CCTTACAAATGTAATGAATGTGG + Exonic
1167865434 19:52322442-52322464 CCTTACAAATGTAATGAATGTGG + Exonic
1167865437 19:52322526-52322548 CCTTACAAATGTAATGAATGTGG + Exonic
1167865451 19:52322694-52322716 CCTTACAAATGTAATGAATGTGG + Exonic
1167870571 19:52366405-52366427 CCTTACAAATGTAATGAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1167872567 19:52384799-52384821 CCTTACAAATGTAATGAATGTGG + Exonic
1167872590 19:52385135-52385157 TCTTACAAATGCAATGAATGTGG + Exonic
1167876312 19:52416158-52416180 CCTTACAAATGTAATAAATGTGG + Exonic
1167876331 19:52416410-52416432 CCTTACAAATGTAATCAATGTGG + Exonic
1167882651 19:52474050-52474072 CCTTACAAATGTAATGAATGTGG - Intronic
1167882669 19:52474302-52474324 CCTTACAAATGTAATGAATGTGG - Intronic
1167882678 19:52474454-52474476 CCTTACAAATGTAATGAATGTGG - Intronic
1167882704 19:52474873-52474895 CCTTACAAATGTAATGAATGCGG - Intronic
1167887335 19:52512422-52512444 TCTTCCGAGTGTAATAAATGTGG + Intergenic
1167892803 19:52555954-52555976 TCTTGCAAATGTCATCAGTGTGG + Exonic
1167896157 19:52583868-52583890 TCTTACAAGTGTAATAAATGTGG + Exonic
1167897961 19:52597084-52597106 TCTTACAAGTGTAATAAATGTGG + Intronic
1167899975 19:52613177-52613199 CCTTTCAAATGTAATGAATGTGG - Exonic
1167899999 19:52613513-52613535 CCTTACAAATGTAATGAATGTGG - Exonic
1167905054 19:52652624-52652646 TCTTACAAGTGTAGTAAATGTGG - Intronic
1167911336 19:52704587-52704609 TCTTACAAGTGTAATAAATGTGG - Exonic
1167918931 19:52765489-52765511 TCTAACAAGTGTAATAAATGTGG - Exonic
1167928153 19:52839853-52839875 TCTTACAAGTGTAATAAATGTGG - Exonic
1167930767 19:52862484-52862506 TCTTACAAGTGTGATAAATGTGG - Intergenic
1167935774 19:52906067-52906089 TCTTACAAGTGTAGTAAATGTGG - Intergenic
1167938746 19:52928558-52928580 CCTTGCAAGTGTAATGAATGTGG - Exonic
1167956410 19:53068318-53068340 CCTTACAAATGTAATGAATGTGG - Exonic
1167956430 19:53068486-53068508 CCTTACAAATGTAATCAATGTGG - Exonic
1167956494 19:53069242-53069264 CCTTACAAATGTAATGAATGTGG - Exonic
1167961542 19:53108624-53108646 CCTTACAAATGTAATCAATGTGG - Exonic
1167965425 19:53141272-53141294 CCTTACAAATGTAATGAATGTGG - Exonic
1167965455 19:53141608-53141630 CCTTACAAATGTAATGAATGTGG - Exonic
1167968092 19:53164679-53164701 CCTTACAAATGTAATGAATGTGG - Exonic
1167968150 19:53165435-53165457 CCTTACAAATGTAATGAATGTGG - Exonic
1167968178 19:53165771-53165793 CCTTACAAATGTAATGAATGTGG - Exonic
1167977146 19:53237669-53237691 CCTTACAAATGTAATGAATGTGG - Exonic
1167987316 19:53329449-53329471 TCTTACAAGTGTAATAAATGTGG + Intergenic
1167987329 19:53329701-53329723 TCTTACAAATGTCATAAAGGTGG + Intergenic
1167990047 19:53351651-53351673 TCTTACAAGTGTAATGAATGTGG + Exonic
1167990172 19:53353331-53353353 CCTTACAAGTGTAATAAATGTGG + Exonic
1167990209 19:53353915-53353937 TTTTGAAAGTGTAATAAATGTGG + Exonic
1167993587 19:53383063-53383085 GCTTGCAAGTGTAATAAATGTGG + Exonic
1167993630 19:53383729-53383751 TCTTACAAATGTAATAATTGTGG + Exonic
927074906 2:19567780-19567802 TCTTGTAAATATAATAAAAGGGG + Intergenic
927181487 2:20449547-20449569 TATAGCAAATGTAGTAAATGAGG + Intergenic
928647834 2:33373954-33373976 TTTTGCAAAAGTAAAGAATTTGG + Intronic
929019272 2:37535353-37535375 CCTTAAAAATGTAATAAATTTGG - Intergenic
930297649 2:49575461-49575483 TCTAGCAAACATAAAAAATTAGG + Intergenic
930485155 2:52002181-52002203 TTTTGTAAATGCAATAAATAAGG - Intergenic
930551136 2:52836168-52836190 TGTTGCAGATGTAATTAGTTAGG - Intergenic
931017244 2:57997497-57997519 TCATGCAACTGTCTTAAATTGGG + Intronic
931491020 2:62747692-62747714 TGTTGCCAATGTAATAGAATAGG + Intronic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
931681771 2:64755672-64755694 TCATGAAAACATAATAAATTAGG + Intergenic
932359708 2:71093887-71093909 TCTTCCAAACATAATAATTTTGG - Intergenic
933015822 2:77125755-77125777 TTTTTCAAATTCAATAAATTAGG - Intronic
933165329 2:79069134-79069156 TCTTGCAGCTGTAACAAACTTGG - Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934537686 2:95149436-95149458 CCTTACAAATGTAATAAATGTGG - Exonic
934537727 2:95149856-95149878 TCTTGTAAATGTAATGAGTGTGG - Exonic
934722918 2:96594279-96594301 TCTAGTTAAGGTAATAAATTAGG - Exonic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
935527253 2:104185846-104185868 ACTTGCAAATTTAAGAATTTCGG - Intergenic
935748177 2:106207834-106207856 CCTTATAAATGCAATAAATTTGG + Intergenic
936926801 2:117745332-117745354 GCTTGCACATGTACTAACTTGGG + Intergenic
937715376 2:125026069-125026091 TGTTGCCAATAAAATAAATTGGG + Intergenic
938471680 2:131569157-131569179 TCTTGAAAATCAAGTAAATTTGG - Intergenic
938523910 2:132105197-132105219 CCATACAAATGTAATAAATGTGG + Intergenic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
939622935 2:144442577-144442599 TCTTTCAAAAATAGTAAATTAGG - Intronic
939761754 2:146191063-146191085 TCTTTCAAATGGTATCAATTTGG + Intergenic
939922844 2:148138287-148138309 TGTTACAGATGTAATAAATGAGG + Intronic
941703795 2:168635655-168635677 TTTTAAAAATGTAATAAAATAGG - Intronic
941876752 2:170441449-170441471 TCTTGCACAAGAAATAATTTGGG + Intronic
942437819 2:176000301-176000323 TTTTGCAAATGCAATAACTGAGG - Intronic
942886871 2:180936584-180936606 TATAAAAAATGTAATAAATTAGG - Intergenic
943610715 2:190030658-190030680 TCTTGTAGATGTGACAAATTTGG + Intronic
943875077 2:193057195-193057217 TCTTTCCAATTTCATAAATTAGG - Intergenic
945343652 2:208687048-208687070 TTTTCCAAATAAAATAAATTAGG + Intronic
946523703 2:220495110-220495132 TCCTGCAAGTGAAACAAATTTGG - Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947307837 2:228766623-228766645 TGTTGCAGATGTAATTAGTTAGG + Intergenic
947945759 2:234100737-234100759 TTTTGGAAATGTAATATTTTTGG + Intergenic
1168899190 20:1346262-1346284 TTTTGCCCATGTAAAAAATTAGG + Intronic
1169671529 20:8107870-8107892 TTTTGCAACTGTAACAAAATAGG - Intergenic
1169823951 20:9745542-9745564 TATTGCAACACTAATAAATTAGG - Intronic
1169884233 20:10380838-10380860 TTTTGCAAATGAAATATGTTTGG - Intergenic
1169955222 20:11095022-11095044 TCCTGAAAGTGTAATACATTAGG - Intergenic
1170984714 20:21246886-21246908 TCTTGCAAAAGAAATACAGTTGG + Intergenic
1173036197 20:39413472-39413494 TCTTGCTGGTGTAATAAATCAGG + Intergenic
1173133273 20:40414640-40414662 TCCTTCAAATGTAATAAAATTGG + Intergenic
1173468151 20:43300866-43300888 TCTTGCAAATGCAAAAACTGAGG - Intergenic
1173753592 20:45495852-45495874 TGTTGCAAATGTAAGAAACTTGG + Intergenic
1173890136 20:46501186-46501208 TCTTATAAATGTAATGAATATGG - Exonic
1174068907 20:47886320-47886342 TCTTGCTAATGTCAGAAGTTAGG + Intergenic
1175456464 20:59118772-59118794 TCATCCGAATGTAATACATTTGG - Intergenic
1176772716 21:13095405-13095427 CCATACAAATGTAATAAATGTGG - Intergenic
1177056192 21:16304930-16304952 ACATGCAAATGTAATAAAACTGG + Intergenic
1177574206 21:22929559-22929581 GCTTGCAAGTGAAATATATTTGG - Intergenic
1177687341 21:24454863-24454885 TCTAGCAAATTTAAAAAATGGGG - Intergenic
1177692527 21:24530001-24530023 TCAGTCAAATGTAATAAACTGGG - Intergenic
1178613808 21:34112329-34112351 TCTTGCAAGTGTAATTATATAGG - Intronic
1178981522 21:37268391-37268413 TCTTGTAAATGTTATAAATGAGG + Intergenic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1180437509 22:15324898-15324920 CCATACAAATGTAATAAATGTGG - Intergenic
1180472185 22:15669038-15669060 TCTTGAAAATCAAGTAAATTTGG - Intergenic
1180520359 22:16195115-16195137 ACATACAAATGTAATAAATGTGG - Intergenic
1183124740 22:35765717-35765739 TCTTGCAAATGTATTTTCTTTGG - Intronic
949454571 3:4225067-4225089 TCTTTCTACTGTAATTAATTTGG - Intronic
949469332 3:4377993-4378015 TCTTGCAAATGTAAACCATGTGG + Intronic
949557730 3:5171933-5171955 TATTGTAAATGTATTAAATACGG + Intronic
950027641 3:9831653-9831675 TTTTGCAACTCTAATAAAATAGG - Intronic
952288357 3:31990352-31990374 TCTTACAAGTGTAATAAATGTGG + Exonic
953114833 3:39982062-39982084 TCTTGGAAATGTAATAAGATAGG - Intronic
953642405 3:44721277-44721299 TCTTGGAAATGTAATGAATGTGG + Exonic
953683252 3:45056116-45056138 TCTTAAAAATGTAGGAAATTAGG + Intergenic
955914969 3:63898734-63898756 TCCTGCAATTTTAACAAATTTGG - Intronic
956064821 3:65386487-65386509 TATTGCCAAAGTTATAAATTGGG - Intronic
956344866 3:68267254-68267276 TCTTACAAATGTTTTAAAATTGG - Intronic
956462189 3:69483822-69483844 TCTTTCAAATAAAATAATTTGGG - Intronic
956965650 3:74456347-74456369 TCATGCTACTGCAATAAATTTGG - Intronic
957449832 3:80365561-80365583 TATTGCACATTTGATAAATTTGG + Intergenic
957455370 3:80436465-80436487 TTTTCTAAAAGTAATAAATTAGG + Intergenic
957708002 3:83815105-83815127 TCTAGCAAATGTCATACAGTGGG - Intergenic
957751745 3:84428012-84428034 TCTTGCAACTTTACTGAATTTGG - Intergenic
957995420 3:87682966-87682988 TCTTGCCAATGTCATAAAAATGG - Intergenic
958708752 3:97691109-97691131 TCTTGCATATGGTATAAGTTAGG + Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959191279 3:103114070-103114092 TTTGGCAAATGTAATAGATAAGG + Intergenic
960291017 3:115884863-115884885 TATAGCAAATGTAATAAAAGAGG + Intronic
960562623 3:119101722-119101744 ATTTGCAAATGTGAGAAATTAGG - Intronic
960920269 3:122739589-122739611 TCTTGCAAATGTAATGAGAGTGG + Intergenic
963289087 3:143468841-143468863 TCTTGCAAATATATTTAATATGG - Intronic
963347330 3:144110743-144110765 ACTTGCACATGTGAAAAATTAGG + Intergenic
963922598 3:150920228-150920250 TCTTGGAAAGATTATAAATTAGG + Intronic
964116791 3:153144451-153144473 CATTGTAAATGTAATATATTAGG - Intergenic
964468182 3:157021940-157021962 TTTTCCAAATGTATTACATTTGG + Intronic
965239945 3:166182889-166182911 TCTTGGTAAAGTAGTAAATTAGG - Intergenic
965685998 3:171303331-171303353 TCATGCTAATGTCATATATTAGG - Intronic
967404052 3:189096729-189096751 TCTTGCAAATCTCCTAAGTTTGG + Intronic
967762262 3:193239845-193239867 CCTAGCAAACATAATAAATTTGG + Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968409452 4:375380-375402 TCCTACAAATGTAATAAATGTGG + Intronic
968416543 4:441005-441027 TCCTACAAATGTAATAAATGTGG - Intronic
968871057 4:3242698-3242720 TGTTGCAAATGTGATTAATTTGG + Exonic
970354864 4:15241883-15241905 TCTTGTAAATTTTATAATTTTGG - Intergenic
970893756 4:21077846-21077868 TGTTCAAAATGTAATAAAATTGG + Intronic
971307255 4:25494413-25494435 ACTTGCCAATGTAATAAAACAGG + Intergenic
971926766 4:33020939-33020961 TCTTGTATTTGTCATAAATTAGG + Intergenic
971976574 4:33696875-33696897 TCTTGCAGATGAGAGAAATTTGG - Intergenic
972038488 4:34557443-34557465 TATTACAAATGTAAAAAATGTGG - Intergenic
972803080 4:42497825-42497847 TATTTCAAATGTAACAAAGTTGG + Intronic
972829363 4:42796769-42796791 ACATACAAATGTAATAATTTTGG - Intergenic
972956595 4:44399908-44399930 ACTTGAAAATGTGATAGATTTGG - Intronic
974904955 4:68044263-68044285 TCATGCTAATGTACTAGATTAGG + Intergenic
976400770 4:84604427-84604449 CCTTGTCCATGTAATAAATTTGG + Intronic
976771201 4:88654816-88654838 TCATTCACATGTAAGAAATTAGG - Intronic
976820947 4:89206526-89206548 TATTTGAGATGTAATAAATTTGG + Intergenic
977112603 4:92977983-92978005 TCTTGCACAAGTTATACATTTGG + Intronic
977808775 4:101335240-101335262 TTTGGCAAATGTAGTAAAATTGG - Intronic
978569335 4:110119120-110119142 TATTGGAATTGTAATAAAATAGG + Intronic
978600032 4:110418186-110418208 TCTTACAAGTGTAGTAAATGTGG + Intronic
978634354 4:110786026-110786048 ACCTGGAAAAGTAATAAATTTGG - Intergenic
979646158 4:123071929-123071951 CCTTTCAACTGTAATAAATAAGG + Intronic
980450652 4:132966281-132966303 TCTTGGAAATGTAATAGTTAGGG + Intergenic
980662918 4:135889077-135889099 TCTTTCCATTGTAATAACTTTGG - Intergenic
980743566 4:136984882-136984904 AATTGCAAATGTAATTATTTAGG - Intergenic
981084777 4:140672076-140672098 TCTTGCATATCTAAAAAAATAGG + Intronic
981217647 4:142189918-142189940 TCTTGTAATTTTAATAAATATGG + Intronic
981807480 4:148733449-148733471 TCTTGCAAATGTCAACAATAGGG - Intergenic
983492200 4:168400685-168400707 TTTTGCAAATAGAGTAAATTTGG - Intronic
983525565 4:168757288-168757310 ACTTGGCAATGTAATACATTGGG - Intronic
984265246 4:177490524-177490546 TTTTGGATATGTAATAATTTGGG + Intergenic
984698011 4:182798928-182798950 ACTGGCAAATGTTTTAAATTGGG - Intronic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
986013215 5:3735393-3735415 TCTTAGAAATGTAACAAATTAGG - Intergenic
987335095 5:16891755-16891777 TCTTGCATATGTAATAAGGAGGG - Intronic
987559066 5:19495194-19495216 TCTTTCAAATTTAATTAAATTGG - Intronic
988331207 5:29842597-29842619 TCTTGCATATTTATTGAATTAGG + Intergenic
989352259 5:40499813-40499835 TGTTGCAGATGTAATTAGTTAGG + Intergenic
989394110 5:40934811-40934833 TCTTGTAGATATAATAATTTAGG - Intronic
989416859 5:41188566-41188588 TATTGCAAATGAATGAAATTGGG + Intronic
989638972 5:43565076-43565098 TCTTGCACAAGAAATAATTTAGG - Intergenic
990392177 5:55335148-55335170 TCTTGCTGATGTTTTAAATTGGG + Intronic
990433811 5:55767069-55767091 TCATGCTAATGAAATAATTTGGG - Intronic
991393636 5:66178615-66178637 TTTTGCAAATTTAAAAAACTGGG - Intronic
992940316 5:81753994-81754016 ACTTCCAAATGTAACAAATCTGG - Intergenic
993245295 5:85443696-85443718 TCTTGCAAAAGTCTTAAATCAGG - Intergenic
994686603 5:102962079-102962101 TCTTCAAAATGTATTACATTAGG + Intronic
994911382 5:105913273-105913295 TCTTGAAAAGGTACTCAATTAGG - Intergenic
995606108 5:113856937-113856959 TCCTGCAAATTTACTGAATTTGG + Intergenic
996647819 5:125838253-125838275 TTTAACAAAAGTAATAAATTTGG + Intergenic
998654652 5:144163661-144163683 TCTTGGGAAGGTGATAAATTGGG + Intronic
998695660 5:144635813-144635835 TCTTTCTAATATATTAAATTTGG - Intergenic
1002150425 5:177224861-177224883 TCTTACAAATGTGACAAAATAGG - Intronic
1002393200 5:178932202-178932224 CCTTACAAATGTAACAAATGCGG + Exonic
1002774435 6:316659-316681 TCTTTCTAATGTAAAAATTTCGG + Intronic
1003996335 6:11544492-11544514 ACTGGAAAATGTAATATATTAGG + Intronic
1004158090 6:13188650-13188672 TCAGGAAAATGTAATTAATTTGG + Intronic
1004215309 6:13698058-13698080 TGTTGGAAATTTGATAAATTTGG - Intronic
1004563133 6:16770449-16770471 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1005140379 6:22625081-22625103 TTTTGCAAATTTCCTAAATTTGG - Intergenic
1005598350 6:27401028-27401050 CCTTACAAATGTAATGAATGTGG + Exonic
1005647049 6:27849556-27849578 TATTGCAAATTAAACAAATTAGG - Intronic
1008371418 6:50735741-50735763 TCTTGGGAATGCAATAATTTAGG - Intronic
1008633871 6:53390000-53390022 TCATTAAAATGTAATAAATGAGG - Intergenic
1008713513 6:54259367-54259389 TCTTTCAAATACAATAATTTTGG + Intronic
1009376505 6:62977636-62977658 TATTACAAATGTAATAACTCAGG + Intergenic
1010027555 6:71237471-71237493 GCTTCCAAATTTAGTAAATTGGG - Intergenic
1010073347 6:71770661-71770683 TCTTGGAAATGTAATCATTTAGG - Intergenic
1010125244 6:72423871-72423893 ACTGGCAAATGTTATAAATCAGG + Intergenic
1010398780 6:75424684-75424706 TCTGGAAAATGCAATAAAGTTGG - Intronic
1010574786 6:77517644-77517666 TCTTGTGAAAGTAATTAATTAGG - Intergenic
1010950724 6:82034001-82034023 TCTTGCATAATTAATATATTTGG + Intergenic
1011166540 6:84454082-84454104 TATTGCCAATGTAATTAGTTAGG + Intergenic
1012341181 6:98125832-98125854 TTTTGCAAATGTCATTAATCTGG + Intergenic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014792924 6:125694868-125694890 TCTTATAAATGTAATAAATATGG + Intergenic
1014838781 6:126192294-126192316 TCTTGCAATTTTACTAAAATGGG + Intergenic
1015577149 6:134683790-134683812 TCTAGCACATGTAAAAATTTTGG - Intergenic
1016327106 6:142915261-142915283 CCTTGCAGATGTAATTAGTTAGG + Intronic
1016647695 6:146428846-146428868 TCTTTAATATGAAATAAATTGGG + Intronic
1016716113 6:147231665-147231687 TCTTGCAAATTTATTAAGTGAGG - Intronic
1017094546 6:150793053-150793075 TCATGCAAAGGTGATCAATTTGG - Intronic
1017268602 6:152480114-152480136 ACTTGGAGATGCAATAAATTGGG - Intronic
1017359439 6:153549313-153549335 ACTTGTAAATGTAATATATAAGG - Intergenic
1017547840 6:155470501-155470523 TCTAGGAAAAATAATAAATTTGG + Intergenic
1017916816 6:158837461-158837483 CATTGCAAATGTAATTAGTTTGG - Intergenic
1021311752 7:19106205-19106227 CCTTTGAAATGTAATAGATTGGG - Intronic
1021395569 7:20143733-20143755 TCTTGCAAATCAGAGAAATTTGG + Intronic
1022586004 7:31612763-31612785 TCTTTCAGATGTGAGAAATTAGG + Intronic
1022660388 7:32361447-32361469 CCTAGCAAATGTAATAAAGAAGG - Intergenic
1023013549 7:35943877-35943899 TCTTTGCAATGTAATGAATTGGG + Intergenic
1024014850 7:45304254-45304276 TTTTACAAATGTAACAAATGTGG + Intergenic
1024014856 7:45304333-45304355 TCTTACAAATGTAACGAATGTGG + Intergenic
1024077579 7:45829957-45829979 TCTTTGCAATGTAATGAATTGGG - Intergenic
1024382995 7:48721353-48721375 TCCTTCAAATGTGAAAAATTGGG + Intergenic
1024404239 7:48959980-48960002 TCTTACATATTTAAAAAATTAGG + Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1025126834 7:56351455-56351477 TCTTTGCAATGTAATGAATTGGG + Intergenic
1025159280 7:56639663-56639685 TCCTACAAATGTAATGAATGTGG - Intergenic
1025623294 7:63194372-63194394 TATAGAAAATGTGATAAATTTGG + Intergenic
1025727309 7:64078567-64078589 CCTTACAAATGTAATGAATGTGG + Intronic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025822151 7:64975959-64975981 AACTGCAAATGTAATATATTTGG - Exonic
1025867619 7:65400381-65400403 CCCTGCAAATGTAATAAATATGG + Exonic
1027552349 7:79614853-79614875 AATTGCAAATGTAAACAATTTGG - Intergenic
1027926549 7:84472004-84472026 TCTTAAAACTGTATTAAATTTGG - Intronic
1029299949 7:99573821-99573843 TCTTACAAATGTATTGAATGTGG + Exonic
1029426964 7:100501579-100501601 TCTCATAAATGTAATAAATGAGG - Intergenic
1029557211 7:101278746-101278768 TCTTTGGAATGTAATGAATTGGG + Intergenic
1030419175 7:109286403-109286425 GCTTGAAAATCTCATAAATTAGG + Intergenic
1030525033 7:110642310-110642332 AACTGCAAATGTAAGAAATTGGG + Intergenic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1030815990 7:114038327-114038349 TTTTGCAAATGAAGTAGATTTGG - Intronic
1031072167 7:117173795-117173817 CCTAGCAAATGTAATAAAGAAGG - Intronic
1031309495 7:120177873-120177895 TCATGCAATTGTAATTACTTTGG - Intergenic
1031315432 7:120252421-120252443 TCATACAAGTCTAATAAATTTGG + Intergenic
1031486262 7:122329639-122329661 TCCTCAAAATGTTATAAATTAGG - Intronic
1031571298 7:123363560-123363582 ACTTTAAAATGTAATTAATTGGG + Intergenic
1033016102 7:137673149-137673171 TGTTGCAGATGTAATTAATTAGG - Intronic
1033388886 7:140907234-140907256 TTTTGCAAATCTATTAAGTTGGG + Intronic
1034910045 7:154988427-154988449 TATTATACATGTAATAAATTAGG - Intronic
1035248128 7:157578225-157578247 TCCTGTGAATGGAATAAATTTGG - Intronic
1035414946 7:158675156-158675178 TCTTGTACATATAATATATTTGG - Intronic
1035676151 8:1457102-1457124 TCTTGCAACTCCAATAAAATAGG - Intergenic
1036988395 8:13564093-13564115 TTTTGCAAAAGTAATAATATAGG - Intergenic
1037080764 8:14783098-14783120 AATTGCAAATAAAATAAATTAGG + Intronic
1039132241 8:34279360-34279382 TACTGCAAATGTAATGGATTTGG - Intergenic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1041556290 8:59159967-59159989 TCTAGCAAAAAAAATAAATTTGG - Intergenic
1041610437 8:59840401-59840423 TCTTATAAATAAAATAAATTTGG + Intergenic
1043185452 8:77142628-77142650 TAATGCAAATGGAATAAATCAGG - Intergenic
1043737365 8:83765471-83765493 TCTTTGAAATGTAATAATTAAGG - Intergenic
1043815691 8:84798474-84798496 TTTTGCAAATGAAATAATTGAGG + Intronic
1044093901 8:88038346-88038368 TCTGGCAAATGTCATGAATAAGG - Exonic
1045096442 8:98802299-98802321 TCTTGAAATTATAAAAAATTAGG - Intronic
1046153581 8:110258378-110258400 TCTTTAAAATGTAATCAATTAGG - Intergenic
1046694997 8:117330139-117330161 TCTTTCAAATGTCATCACTTTGG - Intergenic
1047433420 8:124814073-124814095 TCAGGCAAATCTAATCAATTTGG + Intergenic
1048738278 8:137526028-137526050 TCTTGGAAATGGAAAAAACTGGG + Intergenic
1049929575 9:443344-443366 TCTTGGAAGTGAAATAAGTTTGG - Intronic
1050197196 9:3098322-3098344 TCTTTGAAATCTAATAACTTAGG - Intergenic
1050865997 9:10500165-10500187 TCATGCATATGTATTACATTTGG + Intronic
1051041188 9:12813625-12813647 TATTGGAAATGTAATAACTAGGG - Intronic
1051086338 9:13353512-13353534 ACTTACACATGTACTAAATTGGG + Intergenic
1051783344 9:20714510-20714532 TCATGGAAATGGGATAAATTGGG + Intronic
1051903998 9:22074356-22074378 TCCTGCAGATAAAATAAATTGGG - Intergenic
1052208808 9:25876167-25876189 TCTTACAAATCAAATAAATGGGG - Intergenic
1052282361 9:26747873-26747895 TAATAAAAATGTAATAAATTAGG - Intergenic
1052599290 9:30603629-30603651 ACTTGGAAATATAGTAAATTTGG + Intergenic
1053383069 9:37664790-37664812 CCTTATAAATCTAATAAATTAGG + Intronic
1053702656 9:40712805-40712827 CCATACAAATGTAATAAATGTGG + Intergenic
1054412716 9:64836269-64836291 CCATACAAATGTAATAAATGTGG + Intergenic
1055249391 9:74283946-74283968 TATTGTAAATGTAATAATTCAGG - Intergenic
1055557187 9:77486824-77486846 TCTTCCTAATGTAATTATTTGGG - Intronic
1056272656 9:84961874-84961896 CCTTGCAAATGGAACAATTTAGG - Intronic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057640814 9:96819277-96819299 TCTTACAATTTCAATAAATTTGG - Exonic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1059143857 9:111879447-111879469 GCTTGCATATAGAATAAATTTGG + Intergenic
1061240332 9:129367134-129367156 TTTTGAAAGTCTAATAAATTAGG + Intergenic
1185751982 X:2618833-2618855 TCTTGCAAATGATAATAATTGGG - Intergenic
1186067053 X:5777497-5777519 TCTTGTAATTGTAATAATGTGGG - Intergenic
1188574664 X:31632438-31632460 TTTTTAAAATGTGATAAATTAGG + Intronic
1190047131 X:47121421-47121443 TGTTGCAGATGTAATTAGTTAGG - Intergenic
1190815167 X:53923442-53923464 TCTTGCACATGAAATAATTCAGG - Intergenic
1191067121 X:56360628-56360650 TCATGCAAAAGTATAAAATTGGG + Intergenic
1192193164 X:69008384-69008406 GCTTGCAAATTTGATAACTTAGG - Intergenic
1193302695 X:79909863-79909885 TTTTGCAACTGTACTAAATAAGG + Intergenic
1194491303 X:94553272-94553294 TATTGAAAATGTGATAACTTGGG - Intergenic
1194757664 X:97756650-97756672 TATTGCAAATTTAAAATATTGGG + Intergenic
1194789863 X:98134275-98134297 TCTTGAAATTTTAACAAATTAGG - Intergenic
1194876411 X:99194032-99194054 TATTGCCAATGTGAAAAATTAGG + Intergenic
1195118150 X:101720660-101720682 CCCTACAAATGTAATAATTTTGG - Intergenic
1195497740 X:105557164-105557186 TCCTGCAGATGTTATAACTTTGG + Intronic
1195996064 X:110732747-110732769 GCTTGCAAATGGCATAGATTTGG + Intronic
1196133191 X:112179758-112179780 TATTTCAAATATAATATATTAGG + Intergenic
1196145863 X:112316113-112316135 GCTGGCAAAAGTAAAAAATTTGG - Intergenic
1197029194 X:121793506-121793528 TAATGCAAACGTATTAAATTAGG - Intergenic
1198099054 X:133407973-133407995 TCTAACAAATGTTAGAAATTAGG - Intronic
1198220894 X:134600761-134600783 TCTTTCAAATTAAAAAAATTTGG + Intronic
1199027649 X:142958997-142959019 TCTGGCAAAAGTAACAAAATAGG + Intergenic
1200899929 Y:8419698-8419720 GCCTGTCAATGTAATAAATTTGG - Intergenic
1201853215 Y:18511647-18511669 TGTTGCAAAAGAATTAAATTGGG - Intergenic
1201857378 Y:18559641-18559663 ACTTGGAAATGAAATAAAGTTGG + Intronic
1201875943 Y:18760739-18760761 ACTTGGAAATGAAATAAAGTTGG - Intronic
1201880106 Y:18808737-18808759 TGTTGCAAAAGAATTAAATTGGG + Intronic
1201927960 Y:19310802-19310824 TATTTCAAATGAAAGAAATTGGG + Intergenic
1201988805 Y:20001573-20001595 ACTTTCAAATGTGAAAAATTTGG - Intergenic
1201988812 Y:20001659-20001681 CCTTTCAAATGTAATAAGTGTGG - Intergenic
1202250603 Y:22867523-22867545 ACTTGTCAATGTTATAAATTTGG - Intergenic
1202282244 Y:23201958-23201980 TCTTGCAAATGTTATTGTTTAGG - Intergenic
1202283647 Y:23216561-23216583 TCTTGCAAATGTTATTGTTTAGG + Intergenic
1202328042 Y:23713512-23713534 TATTGCAAAAGAATTAAATTGGG + Intergenic
1202345134 Y:23914589-23914611 TATTGCAAAAGAATTAAATTGGG + Intergenic
1202380425 Y:24272471-24272493 TCCTGTAATTGTAATTAATTGGG - Intergenic
1202403592 Y:24501272-24501294 ACTTGTCAATGTTATAAATTTGG - Intergenic
1202433916 Y:24816343-24816365 TCTTGCAAATGTTATTGTTTAGG - Intergenic
1202435323 Y:24830947-24830969 TCTTGCAAATGTTATTGTTTAGG + Intergenic
1202467187 Y:25168810-25168832 ACTTGTCAATGTTATAAATTTGG + Intergenic
1202490358 Y:25397654-25397676 TCCTGTAATTGTAATTAATTGGG + Intergenic
1202525636 Y:25755500-25755522 TATTGCAAAAGAATTAAATTGGG - Intergenic
1202542728 Y:25956540-25956562 TATTGCAAAAGAATTAAATTGGG - Intergenic