ID: 1164033596

View in Genome Browser
Species Human (GRCh38)
Location 19:21433819-21433841
Sequence GCTTCCAGAATGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 9, 3: 37, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164033594_1164033596 -2 Left 1164033594 19:21433798-21433820 CCGCCATTCATAGACTGGTCAGC 0: 1
1: 1
2: 2
3: 10
4: 85
Right 1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG 0: 1
1: 1
2: 9
3: 37
4: 199
1164033595_1164033596 -5 Left 1164033595 19:21433801-21433823 CCATTCATAGACTGGTCAGCTTC 0: 1
1: 2
2: 19
3: 40
4: 150
Right 1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG 0: 1
1: 1
2: 9
3: 37
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164033596 Original CRISPR GCTTCCAGAATGACCAGAGC AGG Intronic
900119634 1:1042975-1042997 GCTTCCTGATTGTCCACAGCAGG - Intronic
901123756 1:6914981-6915003 GCTTCAAGAATAAGCAGAGCGGG + Intronic
901857162 1:12052077-12052099 GATTTCAGAATGACCAGGTCAGG - Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902778554 1:18690225-18690247 GCTTCCAGGAATACCAGAGATGG + Intronic
903041237 1:20532370-20532392 GCCTCCAGAAGGAACATAGCTGG + Intergenic
903161054 1:21489393-21489415 TCTTCCAGAATGCCCAGACGTGG - Intergenic
903267842 1:22168917-22168939 GCTTCCAGAATAACCAAAAAGGG + Intergenic
903469739 1:23577852-23577874 GCTTCTAGAATGACCAGCCCAGG - Intergenic
904500734 1:30911439-30911461 GCTTCCAGAAGTCTCAGAGCTGG - Intergenic
904578562 1:31522773-31522795 CCTTCCAGAAAGACGAGAGAAGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
908515181 1:64884937-64884959 GCTTGCAGAATGACCCAAGGAGG + Intronic
908858564 1:68456464-68456486 GCTGCCTGAATGAACTGAGCAGG + Intergenic
911703432 1:100982799-100982821 GCTTCCTGAATGCCGGGAGCTGG + Intergenic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
919793680 1:201308502-201308524 GTCTCCATAATGACCAGAGTTGG - Intronic
921703973 1:218298678-218298700 GCTACCATATTGAACAGAGCAGG - Intronic
922982978 1:229844064-229844086 GCCTGCAGAATCACCAGAGAAGG - Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1067223801 10:44362716-44362738 CCTTCCAGACTGACCAAGGCCGG + Intergenic
1067471384 10:46541159-46541181 GCTTCCAGAAAGGACAGAGATGG - Intergenic
1069822371 10:71235692-71235714 GCTTAGAGAATGGCCAGGGCTGG + Intronic
1070399440 10:76040422-76040444 GCTTTCAGATATACCAGAGCAGG - Intronic
1074609464 10:115007387-115007409 GCTTACAGAATGAAAATAGCTGG + Intergenic
1074892093 10:117744203-117744225 GCTTCCAGAGTGGTCAGAGAGGG + Intergenic
1076207509 10:128614956-128614978 GCTTCCAGCCAGACCAGAGGAGG - Intergenic
1081388460 11:42500962-42500984 GCTTCAAGAATCTCCAGGGCTGG - Intergenic
1082097653 11:48144301-48144323 GCAGCCAGACTGACCAGTGCTGG + Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085444424 11:76590865-76590887 GTTACCAGAATGCCCTGAGCGGG + Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085648711 11:78247001-78247023 TATTCCAGAATGAAGAGAGCTGG - Intronic
1090262054 11:125328197-125328219 GATCCCACAATGGCCAGAGCAGG - Intronic
1090751030 11:129746684-129746706 GCCTCAAGAAGGCCCAGAGCAGG - Intergenic
1091401811 12:185746-185768 GCTTCCAGTCTGGCCACAGCAGG - Intergenic
1094060571 12:26310909-26310931 GATTCCTGAAGGACTAGAGCTGG - Intergenic
1095762612 12:45856571-45856593 ACTTGCAGAATGCCCAGGGCTGG + Intronic
1103535696 12:121632469-121632491 CCAGCCAGAAAGACCAGAGCTGG - Intronic
1104519391 12:129459025-129459047 GCTTCCAGAATAAGCACATCAGG + Intronic
1107216048 13:37920080-37920102 GCTTCCAGGATGACCACGGCAGG - Intergenic
1110862400 13:80357591-80357613 GCTTCCCCACTGAACAGAGCAGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115521278 14:34235132-34235154 CCCTACAGAATGAGCAGAGCAGG + Intronic
1118085115 14:62405513-62405535 CCTTAGAGAATGACCAAAGCAGG + Intergenic
1118411541 14:65484109-65484131 GCTACCAGAATGAGTACAGCAGG - Intronic
1118492172 14:66271880-66271902 GCTTCAAAGATGAGCAGAGCTGG + Intergenic
1118718277 14:68575663-68575685 GCTTCTAGAATGAACAGGTCAGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1119830445 14:77697348-77697370 CCTTCCAGCATGACCTCAGCTGG + Intronic
1120781667 14:88490970-88490992 GCTTACAGCATGACCAGTTCTGG + Intronic
1122532057 14:102435150-102435172 GCTCCCAGCAGGACCTGAGCCGG + Exonic
1122827864 14:104380001-104380023 ATTTCCAGAATGGACAGAGCTGG + Intergenic
1122834054 14:104422456-104422478 GCTTCCAGGAGGGCCAGGGCGGG + Intergenic
1202888425 14_KI270722v1_random:131398-131420 CTTTTCAGAATGACAAGAGCTGG - Intergenic
1125403683 15:39331318-39331340 GCTTCCAGAGTGACCATTTCAGG - Intergenic
1126908421 15:53392388-53392410 GCTTCCGGAAGGCACAGAGCTGG - Intergenic
1128345630 15:66850768-66850790 GCTTCCTGAATGAGAGGAGCTGG - Intergenic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1129298216 15:74611296-74611318 AGCTCCAGAATGCCCAGAGCTGG - Intronic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1130046541 15:80450251-80450273 GCTTCCTGGATCTCCAGAGCTGG - Intronic
1131667491 15:94585917-94585939 GCTCCCAGAATTACCAAAACAGG - Intergenic
1131937562 15:97523164-97523186 GCTCCCAGCCTCACCAGAGCTGG - Intergenic
1132927181 16:2436890-2436912 GCTTCCGGGAGGACCACAGCAGG + Intronic
1133001166 16:2852450-2852472 CCTTCCTGAAGCACCAGAGCTGG + Intergenic
1133701728 16:8315458-8315480 GCATGCAAAATGACCAGTGCTGG - Intergenic
1134212667 16:12290831-12290853 GCTTCCAGAATCACCATGGCAGG - Intronic
1134366465 16:13583605-13583627 GCTTCAAAAATGGCCAGAGTTGG + Intergenic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1137855983 16:51795117-51795139 GCTCCCAGAATGCCAAGACCAGG - Intergenic
1138463900 16:57172860-57172882 CCTTTCAGAATGTCCAGAGGAGG - Exonic
1140183130 16:72740557-72740579 TGTTCCAGAATGACAAGACCAGG + Intergenic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1140980663 16:80105789-80105811 GCATCCAGAATGTCCAAAGATGG + Intergenic
1141113651 16:81290392-81290414 GCATCCAGAATGAGCAGAAAAGG - Exonic
1142187320 16:88700819-88700841 GCTGCCAGGAGGGCCAGAGCCGG - Intronic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1142614003 17:1124697-1124719 CCTTCCAGAGTGAACAGAGGAGG + Intronic
1144380808 17:14696130-14696152 GCTTAATGAATGACCAGGGCTGG - Intergenic
1147953019 17:44117517-44117539 GCTTCCTGCAGGCCCAGAGCCGG - Exonic
1148239473 17:45990677-45990699 GCTTCCAGATTGCCCTGATCTGG + Intronic
1149433850 17:56617007-56617029 TCTCCCAGGTTGACCAGAGCTGG - Intergenic
1152427681 17:80227093-80227115 CCTTCTAGAATGTCTAGAGCAGG + Intronic
1153433624 18:5045575-5045597 GTTGCCAGAATGAGGAGAGCTGG + Intergenic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1158516548 18:58135254-58135276 GCTTCCAGAACGAGGAGAGAAGG + Intronic
1160010426 18:75103276-75103298 TCTTCCACAATGAGCAGGGCTGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1161394721 19:4038900-4038922 TCTTCCAGCAGGACCAGACCAGG + Exonic
1162400982 19:10446442-10446464 GCTTCCAGCAGGACCAGGCCTGG - Intronic
1163318827 19:16560079-16560101 GCTTTCAGACTGACCACAGGCGG - Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1164575129 19:29401455-29401477 GCTTCCAGACAGCCCAGAGTGGG + Intergenic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1166675591 19:44738843-44738865 GCTGCCCGAATGAGCAGGGCAGG + Intergenic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1202663825 1_KI270708v1_random:98190-98212 CTTTTCAGAATGACAAGAGCTGG - Intergenic
925711253 2:6743042-6743064 GCTTCCAGCATGGCCATCGCTGG + Intergenic
926288113 2:11506729-11506751 ACTGGCAGAATGACCAGAGTTGG + Intergenic
926969896 2:18456074-18456096 GCTGCCACAAAGACCAGAGAAGG - Intergenic
928385627 2:30865561-30865583 GCTTAGAGAATAAACAGAGCAGG + Intergenic
929228982 2:39539937-39539959 GCTTCCAGCCTCCCCAGAGCAGG + Intergenic
930316010 2:49797766-49797788 TCTTCCAGAGTGCCCAGAACTGG - Intergenic
930979207 2:57501643-57501665 CCTTCCAAAATGAGCAGAGTTGG + Intergenic
933729484 2:85446213-85446235 GCTTTCAGAAGGAATAGAGCTGG - Intergenic
934759784 2:96848159-96848181 GCTTCCACAGTGACCAGACTGGG + Exonic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
947934691 2:233993779-233993801 ACTTCCAGGATGCTCAGAGCAGG - Intronic
947960880 2:234236258-234236280 GCTTCCAGAAGGAATACAGCAGG + Intergenic
948026596 2:234782907-234782929 GCTTCCAGAAGGAACACAGCCGG + Intergenic
948454061 2:238096659-238096681 GCTGCCAGAATGGCCAGTGCTGG + Intronic
948776296 2:240290559-240290581 GCTTCCAGTAGGAACTGAGCTGG + Intergenic
1170059032 20:12240171-12240193 GCTGGCAGAATGACTGGAGCTGG + Intergenic
1172802292 20:37584671-37584693 GCTTCCGGAATGACCAGGATGGG + Intergenic
1175861093 20:62150897-62150919 GCTTCCAGAATCGGCAGAGCTGG + Intronic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179842321 21:44085149-44085171 GTCACCAGAATGACCAGGGCAGG - Intronic
1181696195 22:24593978-24594000 GCTGCCAGCTTGCCCAGAGCTGG - Intronic
1182101152 22:27658538-27658560 CCTTGCAGAATGACCCCAGCAGG + Intergenic
1184038063 22:41927901-41927923 CCTTCCAGGATGACGTGAGCTGG - Intergenic
1185413000 22:50695699-50695721 CCTTCCAGAATGCCCTGGGCAGG + Intergenic
952401889 3:32970797-32970819 GCTTCCAGTGTGGTCAGAGCAGG - Intergenic
952403629 3:32986120-32986142 GCTTCCATAATTGCCAAAGCAGG - Intergenic
955025447 3:55163232-55163254 GCTTCTAGAATAATTAGAGCTGG + Intergenic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
955596140 3:60592756-60592778 GCTCCCAGAAGAAACAGAGCTGG + Intronic
955719486 3:61866355-61866377 GCTTACAGAAGGGCCAGAGGTGG + Intronic
956420867 3:69085329-69085351 GCTTGCAGAATTGCCAGGGCAGG - Intronic
957616179 3:82530445-82530467 TTTTCCAGAGTGACCAGGGCTGG + Intergenic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
959079365 3:101783741-101783763 GTTTCCACAATGGCCAGAGAGGG - Intronic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
962400886 3:135057848-135057870 GCTCCCACAATGGCCTGAGCAGG - Intronic
965460319 3:168953942-168953964 GGTTCTAGAATGACCAGAAGAGG + Intergenic
966620098 3:181954125-181954147 GTTTCCAGAAGGATCAGGGCAGG - Intergenic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971297326 4:25408360-25408382 ACTTCCCAAATGACCAAAGCAGG - Intronic
971728908 4:30350552-30350574 GATGCCAGCATGGCCAGAGCAGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976539 4:68901154-68901176 GCTCCCAGTGTGACTAGAGCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
978093157 4:104742534-104742556 GGTTTCAGAAGGACCTGAGCAGG + Intergenic
978686924 4:111456746-111456768 TCTTCCAGTTTGTCCAGAGCAGG - Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
981013999 4:139954508-139954530 GCTTCCAGAATGCACGGAGTGGG + Intronic
981687734 4:147473616-147473638 GATTACAGCATGACCAGAGTGGG - Intergenic
985893213 5:2732450-2732472 GCTGCCAGTAGGACCTGAGCGGG + Intergenic
986377178 5:7144197-7144219 CCTTCCAAAATGAACAGGGCTGG + Intergenic
989190165 5:38662953-38662975 ACTTCCAGAATAACCAAGGCAGG - Intergenic
991292466 5:65045906-65045928 GTTTCAAGAATGAGTAGAGCCGG - Intergenic
992156163 5:73957306-73957328 GCTTCTAGAATGAACAGACGTGG + Intergenic
1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG + Intronic
1001816924 5:174677162-174677184 GCTTCAAAAAAGTCCAGAGCAGG - Intergenic
1002064112 5:176643653-176643675 TCTTCAAGAATGACCGCAGCCGG + Exonic
1002503804 5:179665155-179665177 GCTTCCAGACTGCCCAGGCCAGG + Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1004770549 6:18776316-18776338 GTGTCAAGAATGAACAGAGCTGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006808563 6:36805323-36805345 GCTGGCAGAATGAACAGGGCTGG - Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1015174681 6:130293968-130293990 GCTTCAAGACTGACCAGAAGAGG + Intronic
1015946986 6:138513063-138513085 GCTTCCAGAAATATCAGAGGGGG - Intronic
1016266828 6:142242525-142242547 GCTTACAGAATGAAAAGGGCTGG + Intergenic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1022046413 7:26625771-26625793 GCGCCCAGAATGCCCAGAGCTGG - Intergenic
1023861235 7:44218733-44218755 TCCCCCAGAAGGACCAGAGCTGG + Exonic
1024869804 7:53950851-53950873 GTTTTCAGAATGTCCAGAGGTGG + Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026051813 7:66953058-66953080 GCCTCCTAAATGACCAAAGCTGG - Intronic
1026442764 7:70458363-70458385 CATACCAGAAGGACCAGAGCTGG - Intronic
1030346755 7:108442409-108442431 GCTTACACGATGACCAGAGCAGG + Intronic
1031190454 7:118542811-118542833 GCTTCCAAAATCACCATATCAGG + Intergenic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1033607643 7:142939348-142939370 GCTTCCAAGATGACCACAGTGGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1035307009 7:157939906-157939928 GCTTCCTGAATGAACTAAGCAGG + Intronic
1036457111 8:8919396-8919418 GCTTGCAGCATGGCCAAAGCTGG - Intergenic
1036657166 8:10684050-10684072 GCTTCCAGGAGGACCAGGGAAGG + Intronic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1038533141 8:28334933-28334955 GCTGACAGAATGACCTCAGCAGG - Intronic
1039477716 8:37849349-37849371 CCTTCCACAATGACCAGACATGG + Intronic
1040676259 8:49754456-49754478 GCTTCCACAATGTGGAGAGCTGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1042838027 8:73094979-73095001 GCTTCCAGAATTACAAAATCTGG + Intronic
1044931172 8:97253110-97253132 GCTTTCAGAATTTCCAGGGCAGG + Intergenic
1048182198 8:132205834-132205856 GCTTCTAGGAAGACCAGGGCAGG + Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1056906029 9:90648571-90648593 GCAGCCAGGATGAGCAGAGCAGG + Intergenic
1058296040 9:103308366-103308388 GCTGCCAGACTGGCTAGAGCTGG + Intergenic
1058737083 9:107903671-107903693 GGTGCCAGAATGACAAGAGAAGG + Intergenic
1058750383 9:108033490-108033512 GCTACCATATTGACCAGTGCAGG + Intergenic
1058782054 9:108347593-108347615 GCATCCAAAAAGACAAGAGCAGG + Intergenic
1058996587 9:110304791-110304813 GCTACCTGAATGACCAGACTTGG + Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061324707 9:129856532-129856554 GCTGCCAGAATGGCCAGCCCAGG - Intronic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1203485616 Un_GL000224v1:51320-51342 CTTTTCAGAATGACAAGAGCTGG - Intergenic
1186641194 X:11457689-11457711 ACTTCCAGCCTGACCAGTGCAGG - Intronic
1186979889 X:14947454-14947476 GCTTCCAGAATGCTCAGCTCAGG - Intergenic
1188325821 X:28799658-28799680 GATTCCAGAATGACCAGTAAGGG + Intronic
1190006554 X:46745229-46745251 GGTTCCAGATGGAGCAGAGCAGG + Intronic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1196343261 X:114621877-114621899 GCATCCAGAATGAGCAGTGGGGG + Intronic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198786537 X:140294993-140295015 GGGTCCAAAATGAACAGAGCAGG + Intergenic
1200022044 X:153220032-153220054 GCTTCCAGAATCTCCCCAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858319 Y:18569408-18569430 ACTTCCAGGATGACTAGAGCAGG + Intronic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1201875002 Y:18750973-18750995 ACTTCCAGGATGACTAGAGCAGG - Intronic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202168726 Y:22018664-22018686 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202222635 Y:22567704-22567726 GCTTCCAGGATGACTACAGCAGG + Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202320480 Y:23627956-23627978 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202550287 Y:26042100-26042122 GCTTCCAGGATGACTACAGCAGG + Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic