ID: 1164034281

View in Genome Browser
Species Human (GRCh38)
Location 19:21439354-21439376
Sequence TCTGGTTCCCAGGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164034271_1164034281 24 Left 1164034271 19:21439307-21439329 CCAGTCTTTCATTTCAGGGTGAG 0: 1
1: 0
2: 2
3: 17
4: 198
Right 1164034281 19:21439354-21439376 TCTGGTTCCCAGGGGGCTGCTGG 0: 1
1: 0
2: 1
3: 52
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164034281 Original CRISPR TCTGGTTCCCAGGGGGCTGC TGG Intronic
900363594 1:2301487-2301509 GCTTGTTCCCTGAGGGCTGCAGG + Intronic
900524225 1:3120618-3120640 TCCCGCTCCCAGGGGGCTGCCGG - Intronic
900614949 1:3561284-3561306 TTGGGTCCCCAGGGGGCTCCTGG - Intronic
900964843 1:5950722-5950744 GCTGGTCCGCTGGGGGCTGCTGG - Intronic
901821947 1:11835905-11835927 GCTTGCTCCCAGGGGCCTGCGGG + Intronic
901842919 1:11964970-11964992 GCTGGTCCTCAGGGGTCTGCAGG + Intronic
901987361 1:13086568-13086590 TCTGGTTCCTGGGGGACTGTTGG - Intergenic
901994451 1:13140199-13140221 TCTGGTTCCTGGGGGACTGTTGG + Intergenic
902098832 1:13968109-13968131 AATGGTTCCCAGGTGGCTCCTGG + Intergenic
902830579 1:19009827-19009849 ACTGGCTCTCAGGGGACTGCGGG + Intergenic
904329000 1:29745734-29745756 TCTCTTCCCCAGGGAGCTGCAGG + Intergenic
904565934 1:31428525-31428547 TCAGGTTCCCAGGGCTCCGCAGG + Intronic
905179170 1:36156066-36156088 GCTGGGTCCCGGGGCGCTGCTGG + Intronic
905365140 1:37447280-37447302 TCTTGTGGCCAGGGGGCTGGTGG - Intergenic
905733609 1:40312102-40312124 TCTGCTCCCCAGGGGCCTCCTGG - Exonic
906536104 1:46551791-46551813 TCTGGGTCCCAGGGCCCAGCGGG + Intergenic
906944209 1:50281756-50281778 TCTTCTTCCCAGGGGGTTGCAGG - Intergenic
907430672 1:54409488-54409510 TCTCGGTCCCTGGGGGCTCCTGG - Intronic
908128227 1:61050771-61050793 TCGGGTTCCCAGGGAGGGGCCGG - Intronic
911477356 1:98389963-98389985 TCTGGTTCCCATCAGGCTCCTGG - Intergenic
912572723 1:110636387-110636409 GCTGATTCCCAGGTGTCTGCAGG + Intergenic
912911137 1:113759811-113759833 TCTGTTCCCCAGTGGGCTGTGGG + Intergenic
914886164 1:151586125-151586147 TCTGTGTCTCAGGGGGCTCCAGG - Intergenic
915279719 1:154814125-154814147 TCTGCATCCTAAGGGGCTGCGGG - Intronic
915531197 1:156503155-156503177 TCTGGGACCCAGGGGTCTGACGG - Intergenic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG + Intergenic
916620069 1:166487443-166487465 ACAGGTTCCCAGGGGTCTGCTGG - Intergenic
919861408 1:201741247-201741269 TCTGGCTTCCAAGGGGCTCCTGG - Intronic
919985361 1:202670383-202670405 TTTGGTGCCCAGGGAGCTACTGG + Intronic
920652599 1:207850158-207850180 TCTGGCTCCCAGGGGACAGTTGG - Intergenic
920876686 1:209842710-209842732 TGTGGTCCCCAGGGGCCTGCTGG - Intronic
1065149946 10:22812474-22812496 TCTGGAACCCAGGAGGCTGATGG + Intergenic
1065801468 10:29356704-29356726 TCTGGCTCCCAAGGGGCCGGTGG + Intergenic
1065967778 10:30783209-30783231 TGTGGTAGCCAGGTGGCTGCTGG + Intergenic
1067415394 10:46098189-46098211 TCTGGAGCACAGGGGCCTGCAGG + Intergenic
1067435438 10:46273265-46273287 TCTGGAGCACAGGGGCCTGCAGG + Intergenic
1067438282 10:46294096-46294118 TCTGGAGCACAGGGGCCTGCAGG - Intronic
1070006273 10:72427208-72427230 GTTGTTCCCCAGGGGGCTGCAGG + Intronic
1070154234 10:73823963-73823985 GCTGGGTCCCAGGGGTCTACAGG - Intronic
1070797342 10:79224426-79224448 TCTGGTTCCCCGAGAGCTCCAGG + Intronic
1071301078 10:84256653-84256675 CCTGGCTCCCAGCTGGCTGCTGG + Intronic
1073542285 10:104323968-104323990 CGTGGTACCCTGGGGGCTGCAGG - Intronic
1075905806 10:126081088-126081110 GCTGGATTCAAGGGGGCTGCAGG + Intronic
1076055727 10:127370809-127370831 TCATGTTCTCAGAGGGCTGCTGG + Intronic
1076178256 10:128385380-128385402 GCTGGGTCCCAAGGCGCTGCTGG + Intergenic
1076577109 10:131476542-131476564 CCTGGCTGCCAGGGGGCCGCAGG - Intergenic
1076739844 10:132477726-132477748 ATGGGATCCCAGGGGGCTGCGGG + Intergenic
1076848182 10:133080275-133080297 TCTGGTCCCCAGGGAGGGGCTGG + Intronic
1076905836 10:133360532-133360554 TCTGGTTCCCTGAACGCTGCAGG - Intergenic
1077370717 11:2180449-2180471 GCTGGTTCCCATGGGGTAGCAGG - Intergenic
1077752883 11:4992013-4992035 TCTGATTCCCAGAGTGCTGCAGG - Exonic
1078107131 11:8365522-8365544 TTGGGCTTCCAGGGGGCTGCTGG + Intergenic
1078760980 11:14251677-14251699 CCTGCCTCCCAGGGGACTGCTGG + Intronic
1081596880 11:44465605-44465627 TCTGTTTCCCAGGAGGCAGCAGG + Intergenic
1081658578 11:44874034-44874056 TCTGTTTCTTAGGGGGCTTCAGG + Intronic
1083465369 11:62842154-62842176 TCGGCTTTCCAGGGGGCGGCGGG + Intergenic
1083722562 11:64610700-64610722 TCTGGATCCCAGGTGGGTACAGG - Intronic
1083766491 11:64843848-64843870 TCTTGTACCCAGGGAGCTGGGGG + Intronic
1083781909 11:64923187-64923209 ACTGGTACCCAGGGGGCTTGTGG + Intronic
1084165035 11:67371648-67371670 TCTGGCTCTCAGTGGGCTGCTGG - Intronic
1084342239 11:68513059-68513081 TCAGGACCCAAGGGGGCTGCTGG - Intronic
1084463657 11:69309736-69309758 TCAGGGCCACAGGGGGCTGCTGG + Intronic
1084468808 11:69343167-69343189 TCTGGTCCCCAGGGAGCTGAGGG - Intronic
1084662346 11:70553510-70553532 TCAGGATGGCAGGGGGCTGCTGG - Intronic
1084674184 11:70624608-70624630 TCTGGTTCCCTGGGGTTTGGGGG - Intronic
1086406031 11:86499571-86499593 TCTGGTACCCAAAGGGCTACGGG + Intronic
1087130885 11:94668517-94668539 TCATGTTGCCAGGGGGCTGGGGG - Intergenic
1089555325 11:119312806-119312828 TGTGGTTCCCACTGGGCAGCCGG + Exonic
1090902743 11:131047052-131047074 TCAGCTTCCCAGGGAGCTGGGGG - Intergenic
1092185683 12:6476793-6476815 TCTGGAACCCAGGTGCCTGCTGG - Intergenic
1092282837 12:7110312-7110334 TCTGGCTCCCAAGGTGCTCCAGG - Intergenic
1096513695 12:52145313-52145335 TCTGCTTCCCAGGAAGCTGCTGG - Intergenic
1096598903 12:52715543-52715565 TCTGGTTCCCAGGAGGCCAGAGG - Intergenic
1096773764 12:53951996-53952018 TCTGGGTCCCCGGGGCCGGCGGG - Intergenic
1100437419 12:94584360-94584382 TCTGGTTCTGGGGAGGCTGCGGG - Intronic
1103223075 12:119262582-119262604 TCAGGGTCCAAGGTGGCTGCAGG + Intergenic
1104670535 12:130677074-130677096 TGTGGTGCCCAGGGGACAGCAGG + Intronic
1104671806 12:130685967-130685989 TCTGCTCCCCGGGGGGATGCTGG - Intronic
1104720328 12:131041772-131041794 TGTGCTTCCCAGGCGGGTGCAGG - Intronic
1106358723 13:29010359-29010381 TTTGGTTCCAAGGAGGCTGGAGG - Intronic
1106548580 13:30751871-30751893 TTTGTTTCCCAGGTGGCAGCTGG + Intronic
1106862360 13:33923504-33923526 CCTGGTTCCCAGGGGTCTTCAGG + Intronic
1108133902 13:47334276-47334298 TCTGGCTCCCACTGGGCTACAGG + Intergenic
1108174128 13:47774721-47774743 TCTGAATCCAAGGGGGCTCCAGG + Intergenic
1108466977 13:50726367-50726389 GCTGGTTCCCAGGGGGATTTGGG - Intronic
1113219780 13:108086826-108086848 TCTGGGTCCCACGGAGCTCCTGG - Intergenic
1113928031 13:113952050-113952072 TCTGGTTCCTTGGGGGCTGTCGG - Intergenic
1114355727 14:21905889-21905911 ACTGGATTCCAGGCGGCTGCTGG + Intergenic
1114619287 14:24085426-24085448 TCTAGTTCCCAGATGGCTGAGGG + Intronic
1116290285 14:43026463-43026485 TCTGCTTCTGAGGAGGCTGCAGG - Intergenic
1116756615 14:48956821-48956843 GCTGGTTCCCAGGGGCTTGGAGG + Intergenic
1119404488 14:74389084-74389106 TCTGGGTCCTTAGGGGCTGCTGG + Intergenic
1119667129 14:76492905-76492927 GCTGGGTGCCAGGGGGCTGCAGG + Intronic
1121262083 14:92573759-92573781 GCTGGTTCCCATGGGCCTGGTGG + Intronic
1121329665 14:93041906-93041928 TATGGTTAACAGGGGGCTGCAGG - Intronic
1121408006 14:93730651-93730673 TCTGGTTACCTGGGGGCACCTGG - Intronic
1122035428 14:98945947-98945969 CCTCGTTCCCAGTGAGCTGCTGG + Intergenic
1122470530 14:101963147-101963169 GCTGGGTCCCAGGGGGTTGCTGG - Intergenic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1124415725 15:29471880-29471902 TCTGATTCTCCCGGGGCTGCTGG - Intronic
1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG + Intergenic
1125450393 15:39801352-39801374 TCAGGTTCCACAGGGGCTGCCGG + Exonic
1125608832 15:40957520-40957542 ACTTGTACCCAGGGGGCTGAAGG - Intergenic
1125729207 15:41883313-41883335 TGTGTTTCCCAAGGGCCTGCTGG + Intronic
1126257498 15:46644949-46644971 TCTGGTTCCCAGGAGGTGCCAGG - Intergenic
1126849977 15:52790797-52790819 TTTATTTCCCGGGGGGCTGCTGG + Intronic
1128054717 15:64691084-64691106 TCTGATTCCAAGTGGACTGCAGG + Intronic
1128799471 15:70488455-70488477 TCTGCCTCCCAGGTGGCTGTGGG - Intergenic
1129110499 15:73334406-73334428 TCTGGTGCTCAGGGACCTGCTGG - Intronic
1130270141 15:82441876-82441898 ACTGGTTGGCGGGGGGCTGCAGG + Intergenic
1130275830 15:82475965-82475987 ACTGGTTGGCGGGGGGCTGCAGG - Intergenic
1130462482 15:84169197-84169219 ACTGGTTGGCGGGGGGCTGCAGG + Intergenic
1130468189 15:84203357-84203379 ACTGGTTGGCGGGGGGCTGCAGG - Intergenic
1130474105 15:84248119-84248141 ACTGGTTGGCGGGGGGCTGCAGG + Intergenic
1130481520 15:84362187-84362209 ACTGGTTGGCGGGGGGCTGCAGG + Intergenic
1130490195 15:84425596-84425618 ACTGGTTGGCGGGGGGCTGCAGG - Intergenic
1130496075 15:84470185-84470207 ACTGGTTGGCGGGGGGCTGCAGG + Intergenic
1130501782 15:84504346-84504368 ACTGGTTGGCGGGGGGCTGCAGG - Intergenic
1130590482 15:85207955-85207977 ACTGGTTGGCGGGGGGCTGCAGG - Intergenic
1131371552 15:91886029-91886051 TGTGGCTCACAGGGGCCTGCCGG - Intronic
1131800989 15:96069409-96069431 TCTGAGTCCCAGGGGGCAGGTGG - Intergenic
1132185676 15:99800100-99800122 TCTGGTTCCCAAGCGAGTGCAGG + Intergenic
1132430684 15:101758720-101758742 TCTGGTTCCCACGCGAGTGCAGG - Intergenic
1132431001 15:101761597-101761619 TCTGGTTCCCACGCGAGTGCAGG - Intergenic
1132577786 16:671914-671936 TCGGGGCCCCAGGGCGCTGCTGG - Exonic
1134078705 16:11309981-11310003 TCTGATCCCCAGGGAGCTGGGGG - Intronic
1134112117 16:11522151-11522173 TTGGGATCCCAGAGGGCTGCAGG - Intronic
1135040185 16:19112462-19112484 CCTGGTTCCCAGGTGGCAGCTGG + Intergenic
1136138568 16:28274033-28274055 AGTGGTTGCCAGGGGGCTGGCGG + Intergenic
1136714462 16:32265940-32265962 TCTGTTCTCCAGGGGGCTGCTGG + Intergenic
1136753427 16:32663477-32663499 TCTGTTCTCCAGGGGGCTGCTGG - Intergenic
1136814686 16:33206888-33206910 TCTGTTCTCCAGGGGGCTGCTGG + Intronic
1136821162 16:33316968-33316990 TCTGTTCTCCAGGGGGCTGCTGG + Intergenic
1136827725 16:33373507-33373529 TCTGTTCTCCAGGGGGCTGCTGG + Intergenic
1136832791 16:33472278-33472300 TCTGTTCTCCAGGGGGCTGCTGG + Intergenic
1140112219 16:72013940-72013962 TCTGGTTCCCCGTGGGAGGCTGG + Intronic
1140928051 16:79601207-79601229 TCTGGTACCCAGGTGTCTGCCGG + Intergenic
1141041998 16:80680844-80680866 TCAGGATCTCAGGGGGCTGGAGG - Intronic
1141110328 16:81266313-81266335 TGTGGTTCCCAGGAGGGTCCTGG - Intronic
1141154235 16:81585955-81585977 CATGGTGCCCAGGGCGCTGCCGG + Intronic
1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG + Intergenic
1142315257 16:89340387-89340409 TCAGCTACTCAGGGGGCTGCAGG - Intronic
1142349904 16:89575236-89575258 TCTGATTCCGAGGGGTCCGCGGG - Intergenic
1202993262 16_KI270728v1_random:29862-29884 TCTGTTCTCCAGGGGGCTGCTGG + Intergenic
1203055588 16_KI270728v1_random:923829-923851 TCTGTTCTCCAGGGGGCTGCTGG - Intergenic
1144943192 17:18955509-18955531 TCTGGGGCTCTGGGGGCTGCTGG - Intronic
1146179966 17:30691689-30691711 TCAGCTTCCCAGGGAGCAGCTGG - Intergenic
1147252334 17:39160475-39160497 TCTGGTTCACAGTTGGCTCCTGG - Intronic
1147890160 17:43711388-43711410 CCTGTTTCCCCAGGGGCTGCTGG - Intergenic
1149262995 17:54899896-54899918 TCTGGTTCTGAAGGGGCAGCTGG + Intronic
1151283405 17:73092782-73092804 TCTGGTTCACAGCCGTCTGCAGG + Intergenic
1151298551 17:73204252-73204274 ACTGGTTCACTGGGGGCTCCGGG + Intronic
1152068547 17:78124327-78124349 TGGGGTTCCCATGGGGCTGGAGG - Intronic
1152392197 17:80009668-80009690 TCACGTGCCCAGTGGGCTGCAGG + Intronic
1152601866 17:81266694-81266716 TCTGTTTCCCAGGTGGCTGTTGG - Intronic
1152649197 17:81484111-81484133 TTAGGATCCGAGGGGGCTGCCGG + Intergenic
1153502450 18:5762942-5762964 TCTGGTGCCAAGTGGGCTGTGGG - Intergenic
1153782705 18:8508493-8508515 TGTCGTTCCCAGCAGGCTGCAGG + Intergenic
1156015959 18:32547358-32547380 AGTGGTTCCCAGGGAGCAGCTGG - Intergenic
1157428467 18:47603726-47603748 AGAGGTTCCTAGGGGGCTGCAGG + Intergenic
1157443690 18:47729343-47729365 GCTTGTTTCCAGGGGGCAGCCGG + Intergenic
1157493548 18:48139727-48139749 TCCTGTTCCCAGGAGGCAGCTGG - Intronic
1157662294 18:49456144-49456166 TCTGGGTCCAAGATGGCTGCTGG - Intronic
1157693940 18:49705739-49705761 GGTGGTTGCCAGGGGGCTGGTGG - Intergenic
1160735105 19:658788-658810 TCTTCTTCCCAGGTGGCTTCAGG + Intronic
1160838723 19:1136899-1136921 CCGGGTCCCCATGGGGCTGCAGG - Intronic
1160953938 19:1681071-1681093 TCTGTGACCCAGGGGGCAGCTGG + Intergenic
1161483471 19:4522478-4522500 TCTCAGTCCCAGGGGGCTGGGGG - Intergenic
1161772763 19:6240250-6240272 GCTGTTTCACATGGGGCTGCAGG - Intronic
1161798418 19:6401291-6401313 TCTGTTTCCCAGGCAGGTGCAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162348864 19:10137047-10137069 TGTGGTTCCCGGTGGGCTGAGGG - Intronic
1162946414 19:14046581-14046603 TGAGGTTCCCAGGGGGAAGCCGG - Exonic
1163367368 19:16883208-16883230 TGTGGTTGCCAGGGGGCAGATGG + Intergenic
1164034281 19:21439354-21439376 TCTGGTTCCCAGGGGGCTGCTGG + Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165333817 19:35155476-35155498 GCAGGATCCCCGGGGGCTGCCGG + Exonic
1165610483 19:37147096-37147118 TCTGGTTCTCATGAGGCTGATGG + Intronic
1166333309 19:42091021-42091043 TCTGGTTCCTTTGGGGCAGCTGG + Exonic
1166381949 19:42359255-42359277 TGTGGCTCCCAGGAGGCTGAGGG + Intronic
1166545989 19:43635232-43635254 TCCGCTCCCCAGGGGGCTCCTGG + Intronic
1166950436 19:46423932-46423954 TTTACTTCCCAGGGGGATGCGGG - Intergenic
1167331206 19:48857439-48857461 CCCGGGTCCCAGGGGGCCGCGGG + Exonic
1167645622 19:50703565-50703587 CCTGGCACCCCGGGGGCTGCTGG + Exonic
1168705272 19:58467137-58467159 TCCGGTTTCCAGGGGGTTCCTGG + Exonic
925093452 2:1173768-1173790 CCTGTGTCCCAGGGAGCTGCAGG - Intronic
925103252 2:1267366-1267388 TCTGGCTCACAGAGGACTGCTGG + Exonic
926125185 2:10267624-10267646 GCTGGTTCCCTGGGAGCTGGGGG + Intergenic
927860616 2:26558036-26558058 TCTGGGGCCCAGGGAGCTACTGG + Intronic
927939217 2:27093183-27093205 CCTGGTTTGAAGGGGGCTGCTGG + Intronic
927978102 2:27355657-27355679 TCTGGTTCCCATGCTGCTCCAGG + Intronic
928396628 2:30947619-30947641 CCTGGTTCCCAGGGACCTGCTGG - Intronic
929234984 2:39595756-39595778 TTTGGTTCCCACTGGGCTGGTGG + Intergenic
929605742 2:43232943-43232965 TATTGTTCCCAGGGTCCTGCAGG - Intronic
930013764 2:46957061-46957083 TCTGACTCCCAGGGCCCTGCTGG + Intronic
932763968 2:74458573-74458595 TGTGGTCCTCAGGGGGCTGTAGG + Exonic
933909972 2:86930762-86930784 TGTGGTCCTCAGGGGGCTGTAGG - Intronic
934022753 2:87972626-87972648 TGTGGTCCTCAGGGGGCTGTAGG + Intergenic
934606531 2:95699506-95699528 TATGGTTCCCAGGGGTCAGAGGG + Intergenic
935336971 2:102025066-102025088 TCTGTTTCTCAGGGAGCTGTGGG + Intronic
936513452 2:113167080-113167102 TCTGGTGCCAAGGGGGCTGGGGG + Intronic
936539935 2:113341634-113341656 CATGGTTCCCAGGGGGCAGAGGG + Intergenic
938953997 2:136281992-136282014 GCTGCTGCCCAGGGGGCTGAGGG + Intergenic
942161991 2:173199155-173199177 TCTGCTTCCCAGGTGAATGCAGG + Intronic
942919766 2:181358182-181358204 TGTGGCTGCCAGGGGGCTGAGGG - Intergenic
944069954 2:195657404-195657426 GCTGGTTCCCTCGGGGATGCGGG + Intronic
944551005 2:200844746-200844768 CCTCCTACCCAGGGGGCTGCTGG + Intergenic
944858617 2:203792497-203792519 TTTGGTTCCCAGGAGGCTGAAGG + Intergenic
944966133 2:204936080-204936102 TCTGTTTCCCAGTGTGCTGTAGG + Intronic
947612752 2:231533826-231533848 GCTGGTCCCCACCGGGCTGCAGG - Intergenic
947645072 2:231732803-231732825 GCTGGTCCCCTGGTGGCTGCAGG + Exonic
947913127 2:233814644-233814666 GCTGGACCCCAAGGGGCTGCAGG + Exonic
947973162 2:234341707-234341729 CCTGGTTCCTAGCGGGCTACTGG - Intergenic
948151938 2:235751393-235751415 TCTGGTGCCCAGGGGGTTGTCGG + Intronic
948155093 2:235775110-235775132 TCTGTTCCCCAGCTGGCTGCAGG - Intronic
948264977 2:236629402-236629424 TCTGGAGACCAGGGGGCTGCTGG + Intergenic
948595308 2:239075964-239075986 TCTGTTTCCCAGGAAGCTGAGGG - Intronic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
948897740 2:240935099-240935121 CCTGTTTCCCAGGTGGCTGTGGG + Intronic
1168790808 20:574598-574620 CCTGGGTCCCAGGGGCCTGCTGG + Intergenic
1169106305 20:2998140-2998162 TCTGGTAGCCAGGAGGCTGGAGG - Intronic
1171015774 20:21540635-21540657 TCTGGATCCCAGGGTCCTGCGGG + Intergenic
1171154417 20:22859202-22859224 TGGGGCTCCCTGGGGGCTGCTGG + Intergenic
1171179854 20:23084505-23084527 TCTGGCCCCCAGGAGCCTGCAGG - Exonic
1172620349 20:36314243-36314265 TCTGGTTCACAGGGGACTCTGGG + Intronic
1174390516 20:50216064-50216086 TCTGTTTCCCAGGAGGCTCCTGG + Intergenic
1175383001 20:58576625-58576647 CCTGACACCCAGGGGGCTGCAGG + Intergenic
1175991685 20:62793081-62793103 TTTGCACCCCAGGGGGCTGCAGG + Intergenic
1176896344 21:14383191-14383213 TACATTTCCCAGGGGGCTGCGGG - Intronic
1177798089 21:25800180-25800202 TCTTATTCCCTGGGGGTTGCTGG - Intergenic
1177941543 21:27417741-27417763 TCTGTTGCCCAGGGGGCTCTGGG - Intergenic
1179500973 21:41808410-41808432 TCAGGCTCCCAGGGAGATGCAGG - Intronic
1179535450 21:42048584-42048606 TCTGCTTCCCCTGGGGCTTCAGG + Intergenic
1179793848 21:43771022-43771044 TCTGGCTCTCAGGGGTCTGGAGG + Intergenic
1179961344 21:44768457-44768479 GCTGGTTCCCAGGCTGCTCCTGG - Intergenic
1180211591 21:46298082-46298104 GCTGGTTCCCCGGGGCCTCCCGG + Intergenic
1181037060 22:20174777-20174799 CCTGTTTCCCAGGGAGCTGTTGG + Intergenic
1181522721 22:23458777-23458799 GAGGGTTCCCAGAGGGCTGCCGG + Intergenic
1181807468 22:25383718-25383740 GCTGGCTCCCAGGCAGCTGCGGG + Intronic
1182450687 22:30418818-30418840 TCTGCTTTCCAGGGGTCTCCTGG - Intronic
1182619393 22:31610620-31610642 TCTGGCTCCCTGGGTTCTGCAGG - Intronic
1183354274 22:37350062-37350084 TGTGGTACGCAGAGGGCTGCTGG + Intergenic
1184467758 22:44678831-44678853 TCTGGGTCCCAGGGCTCAGCTGG + Intronic
1184788965 22:46687531-46687553 TCTGCTTTCCATGGGGGTGCTGG - Intronic
1185370866 22:50460287-50460309 CCTGGTCCTCAGGGGGCGGCTGG + Exonic
950332858 3:12170168-12170190 TCTGGTTCCCTGGAGACTTCAGG - Intronic
952011446 3:28904765-28904787 ACTGGTTCCCAGTGGCTTGCAGG - Intergenic
952445156 3:33373992-33374014 TCAGGTGCCTAGGGGGCTGCAGG - Intronic
953398421 3:42591006-42591028 TCGGGATCCCGAGGGGCTGCGGG + Intronic
953911706 3:46896553-46896575 TCTGGTCCCCAGGGAGCCACAGG - Intronic
954409937 3:50366037-50366059 CCAGGTTGCCAGGGGGCTGAGGG + Exonic
954894358 3:53963375-53963397 TGTGGTTCTCAGGTGGCGGCCGG + Intergenic
955146678 3:56326760-56326782 TCTCATTCCCAGGGAGCAGCAGG + Intronic
955397811 3:58569498-58569520 TCTGGTTCCCAGGGACCCACTGG + Intronic
955751547 3:62189413-62189435 TCTGGTTCCTGGTGGGCTGCAGG + Intronic
956266735 3:67404945-67404967 TCTCTTTGCCAGGGGGCTGGGGG - Intronic
956750604 3:72341193-72341215 TCCTGTTCTCAGAGGGCTGCTGG + Intergenic
957140528 3:76349029-76349051 TCTAGTTCCTAGGGGCCTTCTGG + Intronic
960548557 3:118947140-118947162 TCTAGTTCTTAGGGGGCTGGAGG - Intronic
960583270 3:119298212-119298234 GCTGGTTCCCAGGGGAGAGCTGG - Intronic
962166641 3:133056140-133056162 TATGGTTCCCACCTGGCTGCAGG + Intronic
963141668 3:141950757-141950779 GCAGGTCCCCAGGGGCCTGCAGG - Intergenic
963719253 3:148841094-148841116 TCTGGTTCCCTCGGGGATGTAGG - Intronic
967899756 3:194437380-194437402 TGTGGTTGCCAGGGTGCTGGGGG - Exonic
968518123 4:1023376-1023398 TCTGGCTCCGGGGGGTCTGCAGG - Intronic
969525989 4:7704366-7704388 CCTGATTCCCAGGTGGCTGGGGG - Intronic
969663719 4:8545078-8545100 ACTGCTTCCCAAAGGGCTGCTGG + Intergenic
971419753 4:26464688-26464710 TCTGCTTCCCCGGGTGGTGCTGG + Intergenic
972562941 4:40244824-40244846 GGTGGTTCCCAGGCGACTGCAGG + Exonic
972687572 4:41365856-41365878 ACTGGTTTCCAGGGAGATGCCGG - Intronic
975720596 4:77245131-77245153 TCTGGATCCCATGGGGTTGAAGG + Intronic
982049751 4:151489141-151489163 TCAGGTTCCCAGTGGGATGTGGG - Intronic
983209900 4:164947873-164947895 TCTGGTGCCAAGGGGTCGGCAGG + Intergenic
984880751 4:184408101-184408123 TTTAGGCCCCAGGGGGCTGCTGG + Intronic
985695592 5:1338369-1338391 TCCGCCTCCCAGGTGGCTGCAGG - Intronic
986215694 5:5716967-5716989 TCTTGTTTCCAGGGGGCACCTGG - Intergenic
986543866 5:8874192-8874214 TCAGGTGTCCAGGAGGCTGCAGG - Intergenic
987308978 5:16664657-16664679 TCTGGTCCACAGGGAGGTGCAGG + Intronic
988285874 5:29214996-29215018 GCTGGCTCCCAGGGGACTGGTGG + Intergenic
993135009 5:83949865-83949887 TTTGTTTCCCAGGGGGCTCTGGG + Intronic
996368707 5:122730328-122730350 TCTGTTTCCCTACGGGCTGCAGG + Intergenic
997642569 5:135459012-135459034 TGTGTTTCCCATGGGGCTCCTGG + Intergenic
997697671 5:135874244-135874266 TCAGGAGACCAGGGGGCTGCTGG + Intronic
998745742 5:145258085-145258107 TCTGCTTCTCAGGAGGCTTCAGG - Intergenic
1000888281 5:166773501-166773523 TCTGGTTCCCATGGAGCTCCAGG + Intergenic
1001526163 5:172430341-172430363 TCTGGGTCCCACAGGGGTGCAGG + Intronic
1001828302 5:174764414-174764436 TCTAGTTGCCAGGAAGCTGCTGG + Intergenic
1002295062 5:178225906-178225928 ACTGGTGCCCAGGGGGCTGTGGG - Intronic
1002457772 5:179355493-179355515 TCTTGTGCCCAGGAGGATGCAGG - Intergenic
1002469898 5:179428937-179428959 GCTGGGTCCTAGGAGGCTGCAGG + Intergenic
1004156456 6:13172455-13172477 TCAGGTTACCAGGAGGCTGAAGG + Intronic
1005463913 6:26093353-26093375 TCTGTCTCCCAGGGAGCTGCTGG - Intronic
1006446684 6:34083703-34083725 CCTGGGTCCCAGGAGGCAGCTGG + Intronic
1007269006 6:40621355-40621377 GCTGGTTCCCTGAGGGCTGAAGG + Intergenic
1007636920 6:43305258-43305280 TCTGGTACCAATGGGGCTGGTGG + Exonic
1010177930 6:73051311-73051333 GCTGGTGGCCATGGGGCTGCCGG - Intronic
1011300261 6:85865962-85865984 TCTGTTTCCTGGGGGGCTGTTGG + Intergenic
1012369807 6:98489891-98489913 TTTAGTTCCCAGGGAGGTGCTGG - Intergenic
1013111835 6:107070449-107070471 GCTGGTACTCAGGGGGCGGCTGG + Exonic
1014392260 6:120877255-120877277 TCTGTTTCCAAGGAGGCTGGGGG + Intergenic
1014408036 6:121075974-121075996 TGTGGTTTCCAGGGGCCAGCAGG - Intergenic
1015195151 6:130517639-130517661 TTTGGTTTGCAGGGGGATGCTGG - Intergenic
1016255515 6:142100527-142100549 TGTGCTTCCCAGGGGACTGGAGG + Intergenic
1018214624 6:161514779-161514801 TCTGGTTCCAGGAGGACTGCGGG + Intronic
1018377505 6:163227186-163227208 TCTGCTTCCCAGGAGGCCTCGGG + Intronic
1019119657 6:169792818-169792840 TGGGGTTCCCAAGGGGCTGACGG + Intergenic
1019225490 6:170504238-170504260 TCCCCTTCCCAGGTGGCTGCAGG - Intergenic
1019425766 7:975837-975859 TCTGCATCCCAGGTGTCTGCTGG + Intergenic
1019523889 7:1472212-1472234 CCTGGGTCCCATGGGGCTGCGGG - Intronic
1019588604 7:1817760-1817782 GAGGGTTCCCAGAGGGCTGCCGG - Intronic
1020203541 7:6098501-6098523 TCTGGTGGCCAGGGGGATACAGG + Intergenic
1021551572 7:21876677-21876699 TCACGGTCCCAGGTGGCTGCAGG + Intronic
1021554969 7:21909889-21909911 CTTGGTTTCCAGGGGTCTGCTGG - Intronic
1022410672 7:30136242-30136264 TCGGGATCCCAGGTGGGTGCAGG - Intronic
1022822952 7:33979348-33979370 TCAGGTTCTCAGGGAGTTGCAGG - Intronic
1024213316 7:47226035-47226057 TCTAGTTCTCAGGTGGCTGCAGG - Intergenic
1025280295 7:57621905-57621927 GCTGGAAACCAGGGGGCTGCTGG - Intergenic
1025304438 7:57843596-57843618 GCTGGAAACCAGGGGGCTGCTGG + Intergenic
1029745676 7:102514586-102514608 CATGGTCCCCAGTGGGCTGCTGG + Intronic
1029763615 7:102613565-102613587 CATGGTCCCCAGTGGGCTGCTGG + Intronic
1029918512 7:104237484-104237506 TGTTGTTCCCAAGTGGCTGCAGG - Intergenic
1031951919 7:127901473-127901495 TCTGGTTCCCACACTGCTGCAGG - Intronic
1031974881 7:128087286-128087308 GCTGGATCCCAGGGGGCTTTTGG + Intronic
1031985915 7:128164639-128164661 TGTGAGTCCCAGGGGCCTGCCGG - Intergenic
1031987342 7:128171690-128171712 TCTGCTTCCCCAGAGGCTGCAGG + Intergenic
1032078915 7:128849051-128849073 CCTGGTCCCCAGGGGTCTGCTGG + Intronic
1032240360 7:130154644-130154666 TGTGGTCCCCAGGCAGCTGCAGG - Intergenic
1033363886 7:140656872-140656894 TTTGGTTCCTGGGGGGCTGTTGG - Intronic
1033651867 7:143350141-143350163 TCTGGGTACCTGGGGGTTGCAGG + Intronic
1034411603 7:150945190-150945212 ACTGGGGCCCAGGGGACTGCAGG + Exonic
1034675228 7:152888069-152888091 TCGAGTTCACAGGTGGCTGCAGG - Intergenic
1035158767 7:156935588-156935610 TCTGGGTCCCAGGGGGCCAGTGG - Intergenic
1035264966 7:157685377-157685399 CCTGGTTCTGAGGGGGCGGCGGG + Intronic
1035325778 7:158064926-158064948 CCTGCTTCCAAAGGGGCTGCAGG + Intronic
1035392167 7:158511683-158511705 ACTGGTGCCCAGGGGTGTGCGGG - Intronic
1035742644 8:1939718-1939740 ACTGGTCCCCAAGGGGCTGCTGG + Intronic
1035790178 8:2297208-2297230 TCTGGATCCAAGGGGGCTTCTGG - Intergenic
1035802627 8:2424497-2424519 TCTGGATCCAAGGGGGCTTCTGG + Intergenic
1036445821 8:8821093-8821115 GCCTGTTCCCAGGGGTCTGCAGG + Intronic
1037572717 8:20172323-20172345 TCTGCTTCCCATGGGGCTAGAGG + Intronic
1037769173 8:21789009-21789031 TCGGGCTCCCAGGCGGCTGGCGG + Intronic
1037787693 8:21912328-21912350 ACTGGTGTCCCGGGGGCTGCTGG + Exonic
1038021853 8:23557686-23557708 GCTGCTGGCCAGGGGGCTGCAGG + Intronic
1039960746 8:42245469-42245491 TGTGGCTCCCTGGGAGCTGCTGG - Intergenic
1040291201 8:46125941-46125963 TCTGGTTCCTTGGGGGCTGTTGG - Intergenic
1040498355 8:47986605-47986627 TCTGCTTCCCAGATGGCTACCGG + Intergenic
1041030670 8:53732827-53732849 CCTGGTTCCTGGGGGGCTGCTGG - Intronic
1041719958 8:60966591-60966613 TCTGGGTCCCAGGGAGTTGGAGG + Intergenic
1042784971 8:72536969-72536991 TCTGGTGCCCAGGGCGCGGCTGG - Intergenic
1042873990 8:73424065-73424087 GGTGGTTGCCAGGGGGCTGGTGG - Intronic
1044146741 8:88725250-88725272 TATGGTCCCCAGTGGCCTGCAGG - Intergenic
1044630217 8:94271285-94271307 TATGGTTCCCAGTGGACTACTGG - Intergenic
1045459105 8:102411842-102411864 TCTGGCTCCCGGGGGGCAGGCGG - Intronic
1048225089 8:132577481-132577503 CCTGGTTCCCAGGGAGATGTTGG - Intronic
1048588441 8:135798056-135798078 TCAGGTACCCAGGGTCCTGCTGG + Intergenic
1048823212 8:138398441-138398463 CCTGGTTCCCCGAGGCCTGCAGG - Intronic
1049166407 8:141128630-141128652 GCTGGTCCCCAGGGGTCTGCGGG + Exonic
1049207006 8:141368264-141368286 GCTTGATCCCAGAGGGCTGCTGG + Intergenic
1052022168 9:23538014-23538036 TCAAGTTCCCTGGGGACTGCAGG + Intergenic
1054250831 9:62715669-62715691 ACTGGTCCCCATGGGCCTGCAGG + Intergenic
1056636897 9:88338699-88338721 TCTGGTCCCAAGGTAGCTGCCGG - Intergenic
1057042208 9:91855926-91855948 TCTGGCTCACTGGGGGCTCCTGG - Intronic
1057276440 9:93678233-93678255 TCTGGTTGGCAGGTGGCAGCAGG + Exonic
1057719854 9:97523325-97523347 CCTGGTCCCCAGGGTCCTGCTGG + Intronic
1057890241 9:98864445-98864467 TCTGGTTCCCAGGACACTTCTGG - Intergenic
1058071788 9:100608841-100608863 TCTGATAACCAGGGGGCTGATGG + Intergenic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1059283809 9:113156049-113156071 TCTGGTTTCCAGGAGGCTACAGG + Intronic
1060036389 9:120259640-120259662 TCAGGTTCCCAGCAGGGTGCTGG + Intergenic
1061068345 9:128293299-128293321 TCTTGTTCCCAGGGGGCATCTGG - Intergenic
1061125922 9:128675690-128675712 TCTGGTTCCCAGAGGGAGCCTGG + Intergenic
1061216221 9:129223564-129223586 TCGGGTTCCTAGGTGGCTGTGGG + Intergenic
1061318646 9:129814212-129814234 TCTTCTTCCCAGGTGGCTTCTGG - Exonic
1061392298 9:130324185-130324207 GGTGGCTCCCAGGGGGCTGAGGG - Intronic
1061559629 9:131394237-131394259 TCTGGTTCCGCGGGCGCGGCCGG - Intronic
1061773487 9:132945112-132945134 CCTGTTTCCCAAGGAGCTGCTGG + Intergenic
1061814909 9:133188786-133188808 TCTGGTTCCCAGGGCACAGAAGG + Intergenic
1061880261 9:133565454-133565476 TCTGGGGCCCAGGGAGGTGCGGG - Intronic
1062400569 9:136370813-136370835 CCTGGTTTCCCGGGGGCAGCGGG + Intronic
1062502799 9:136858506-136858528 TGTGGTCCACAGGGGGCTGGGGG - Exonic
1062601166 9:137319222-137319244 TCTGGACACCAGAGGGCTGCTGG - Intronic
1188835347 X:34948090-34948112 TGTGGGCCCCAGGGGGCTCCTGG - Intergenic
1189268886 X:39736520-39736542 GCTGGTCCCCAAGGGGCAGCTGG + Intergenic
1189691987 X:43626147-43626169 TTTGTTTTGCAGGGGGCTGCAGG + Intergenic
1189742806 X:44138241-44138263 ACTGGTTGCCAGGGGGCTGAGGG + Intergenic
1189984949 X:46545463-46545485 TCACGTTCCCAGGGGGCTGTGGG - Intergenic
1191999590 X:67134679-67134701 TCTGGTTGCCAGGGGCTTGGGGG - Intergenic
1196874540 X:120145686-120145708 TGTGGTTTCCAGGCTGCTGCTGG - Intergenic
1202376815 Y:24245933-24245955 ACTGGTTGACGGGGGGCTGCAGG - Intergenic
1202493965 Y:25424188-25424210 ACTGGTTGACGGGGGGCTGCAGG + Intergenic