ID: 1164035305

View in Genome Browser
Species Human (GRCh38)
Location 19:21449147-21449169
Sequence GGGAACTGCCCCATGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164035305_1164035317 25 Left 1164035305 19:21449147-21449169 CCTTGGCACATGGGGCAGTTCCC 0: 1
1: 0
2: 1
3: 23
4: 199
Right 1164035317 19:21449195-21449217 CCTTACACAAAGGATGGTGTAGG No data
1164035305_1164035312 19 Left 1164035305 19:21449147-21449169 CCTTGGCACATGGGGCAGTTCCC 0: 1
1: 0
2: 1
3: 23
4: 199
Right 1164035312 19:21449189-21449211 ACCTCCCCTTACACAAAGGATGG 0: 1
1: 0
2: 0
3: 17
4: 135
1164035305_1164035318 26 Left 1164035305 19:21449147-21449169 CCTTGGCACATGGGGCAGTTCCC 0: 1
1: 0
2: 1
3: 23
4: 199
Right 1164035318 19:21449196-21449218 CTTACACAAAGGATGGTGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 135
1164035305_1164035319 27 Left 1164035305 19:21449147-21449169 CCTTGGCACATGGGGCAGTTCCC 0: 1
1: 0
2: 1
3: 23
4: 199
Right 1164035319 19:21449197-21449219 TTACACAAAGGATGGTGTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 130
1164035305_1164035310 15 Left 1164035305 19:21449147-21449169 CCTTGGCACATGGGGCAGTTCCC 0: 1
1: 0
2: 1
3: 23
4: 199
Right 1164035310 19:21449185-21449207 TGCCACCTCCCCTTACACAAAGG 0: 1
1: 0
2: 2
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164035305 Original CRISPR GGGAACTGCCCCATGTGCCA AGG (reversed) Intronic
900148922 1:1169809-1169831 GGGGACTGCCCCATCTCCCCAGG - Intergenic
901154025 1:7123587-7123609 AGGGACTGCCACATGTGCCTGGG - Intronic
902383485 1:16063594-16063616 AAGAACTGCCCCATGCCCCAGGG - Exonic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
902862768 1:19257906-19257928 GGGAACTGCTCCAGGGGCCCTGG - Exonic
903652930 1:24932235-24932257 GGGCCCTGCGCCAGGTGCCAGGG - Intronic
905767074 1:40610182-40610204 GGCAGCCGCCCCATGTGACAAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906309641 1:44744471-44744493 GTAAACTGCCTCATTTGCCAGGG - Intronic
907412229 1:54290749-54290771 GGGACCTGCGTCCTGTGCCATGG - Intronic
909869012 1:80714941-80714963 AGGAACTGGACCATGAGCCAAGG - Intergenic
912608759 1:111020920-111020942 GGGTATTGCCACATGTGACATGG - Intergenic
914331021 1:146671021-146671043 GGCAGCTGCCCCATGAGACAAGG - Intergenic
920627187 1:207613556-207613578 GGGATCTGCCCCATCTGCCTAGG + Intronic
922698025 1:227741417-227741439 TGGACCTGGCCCATGAGCCAAGG - Intronic
923088513 1:230720495-230720517 GGGACCCGCCCCATCTGCCTAGG - Intergenic
923525366 1:234768488-234768510 TGGTTCTGCCCCATGTCCCAGGG + Intergenic
1063095681 10:2906681-2906703 GGGAACTGGGGCATGTGCTAAGG - Intergenic
1064227782 10:13502835-13502857 GGTATCTGCCCCATGTGGCCTGG - Intronic
1066157594 10:32695303-32695325 GGATACTGCCACATGTCCCAAGG - Intronic
1068383448 10:56291230-56291252 GGAAAATGTCCCATGTGCTAAGG + Intergenic
1068963227 10:62886388-62886410 GGGAACTGCCACATGGACAAAGG + Intronic
1069156603 10:65037623-65037645 GGGACCTGCCCTATCTGCCTAGG - Intergenic
1069590302 10:69637334-69637356 GGCCACTGCCCCAAGTGCCCAGG + Intergenic
1074156283 10:110802734-110802756 TGGAACTGGGCCAGGTGCCATGG + Intronic
1074347955 10:112706659-112706681 GGGAAAGGCCACATGTGCTATGG - Intronic
1074824726 10:117206570-117206592 AGGCACTCCCCCATCTGCCATGG + Intronic
1075446996 10:122519900-122519922 GGGACTTGCCCCAAGTGTCATGG - Intergenic
1076609249 10:131710739-131710761 GGGATCAGCCCCATGTCTCAGGG + Intergenic
1076648606 10:131971732-131971754 GGGTACAGCCCCAAGTGCCCAGG + Intronic
1078101812 11:8334494-8334516 GGGAGCTGGCCCAGGAGCCAAGG - Intergenic
1078721085 11:13883685-13883707 GGCACCTGCCCCATGTTACAAGG - Intergenic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1083944970 11:65918749-65918771 GGGAACCGCCCCATTGGCCTCGG - Intronic
1084003251 11:66310022-66310044 GGGATCTGGACCATGTGCCCAGG - Intergenic
1084616592 11:70240507-70240529 GGTGACTGCCCTGTGTGCCACGG - Intergenic
1085063215 11:73467794-73467816 GGGTACTGCCCCATGAGTCCTGG + Intronic
1086343871 11:85875358-85875380 GGGACCGGCCCCATCTGCCTAGG + Intronic
1090031728 11:123212119-123212141 GGGAGCTGCCCGATGTTCCCGGG + Intergenic
1090293434 11:125566476-125566498 GGCAGCTGCCCCACGTGACAAGG - Intergenic
1090796800 11:130142237-130142259 GGCAACAGCCCCTTGTGGCAGGG - Intronic
1093755775 12:22850527-22850549 GGCAACTGCCCCATGTGAGGAGG - Intergenic
1094840093 12:34339238-34339260 GGGAGCTGCCCAAAGTGGCAGGG + Intergenic
1095375276 12:41519905-41519927 GGGAAGTGCCTCATGTGCTATGG - Intronic
1096386885 12:51200025-51200047 GGAAGCTGCCTCATGGGCCAGGG - Intronic
1097241034 12:57575454-57575476 GGGTACTGCCCCCTGAGCCATGG + Intronic
1099488446 12:83256460-83256482 GAGAACTGGCCCATGTGGCCTGG + Intergenic
1101124304 12:101615127-101615149 GGGGACTGCCCTACCTGCCAAGG - Intronic
1101561169 12:105859449-105859471 GGAAACTGCCCCATGATTCAAGG - Intergenic
1103125780 12:118421190-118421212 GGGGACTGCCCCAGGTGCAGGGG + Intergenic
1104962163 12:132493505-132493527 GGGGTCTGCCCCAGGGGCCAGGG - Intronic
1104975127 12:132548795-132548817 GGGCCCTGCCAGATGTGCCAGGG + Intronic
1106161835 13:27208144-27208166 GGGAACTGGGCCAGGTGCAATGG + Intergenic
1106234228 13:27848219-27848241 GGGAGCTGCTCCCTCTGCCATGG - Intergenic
1108890861 13:55257461-55257483 TGGAAATGTACCATGTGCCAGGG + Intergenic
1118159249 14:63272660-63272682 GGCTACAGCCCCATGAGCCATGG + Intronic
1121933799 14:97997776-97997798 GGGACCTGCCTCATGTTTCAGGG - Intergenic
1126340921 15:47640484-47640506 AAGAAATGCCCCATGTGCTAGGG + Intronic
1132393108 15:101453277-101453299 TGGCCCTGCCCCATGTGCCCAGG + Intronic
1132662955 16:1069686-1069708 GGGCACTGGTCCAGGTGCCAGGG + Intergenic
1132777279 16:1602031-1602053 GGACACTGCCCCATGTCCCCTGG + Intronic
1132809965 16:1792772-1792794 GGGAACTGAGCCATTGGCCAAGG + Intronic
1135926757 16:26701683-26701705 GGGATCCGCCCCATCTGTCAAGG - Intergenic
1138743395 16:59335891-59335913 GGGGCCTTCCCCATCTGCCAAGG + Intergenic
1140002532 16:71039883-71039905 GGCAGCTGCCCCATGCGACAAGG + Intronic
1141219037 16:82051955-82051977 GAGACCTGCACCAGGTGCCAAGG - Intronic
1141777156 16:86132000-86132022 GGCAGCTCCACCATGTGCCAAGG + Intergenic
1142762987 17:2052153-2052175 GGGAACTGCCCCACAAGTCATGG - Intergenic
1143756537 17:9071946-9071968 GGAAACTGCAGCATCTGCCAGGG - Intronic
1145275934 17:21430479-21430501 GGGAACTGTCCTAGGTTCCAGGG - Intergenic
1145313780 17:21716392-21716414 GGGAACTGTCCTAGGTTCCAGGG - Intergenic
1146371642 17:32268207-32268229 GGGAAATCCTCCATATGCCAGGG + Intronic
1148961927 17:51400697-51400719 AGGAACTGTCCTAGGTGCCAGGG - Intergenic
1149218598 17:54388816-54388838 GGGACCTGCCCCATCTGTCTAGG - Intergenic
1149218855 17:54390751-54390773 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1150102307 17:62434279-62434301 GGGAACTGCAGCATTTGCTATGG - Intronic
1150302565 17:64058740-64058762 GGGAAATTCAGCATGTGCCAGGG - Intronic
1150438487 17:65172525-65172547 GTGGAATGCTCCATGTGCCATGG + Intronic
1151513816 17:74579484-74579506 GGGAATAGCCCCAGGTGGCACGG + Exonic
1151596933 17:75083869-75083891 GGTAACTGCCCCAAGGCCCATGG + Intergenic
1153723959 18:7936644-7936666 GGGAACTCCCCCATCTGCCCTGG - Intronic
1153821702 18:8837632-8837654 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1154295018 18:13140057-13140079 GGGAACTGCTCCAGGGGCCCTGG + Intergenic
1156381025 18:36561361-36561383 TGGAGCTGACCCATGTGACAAGG - Intronic
1156946885 18:42844278-42844300 GGCAGCTGCCCCATGTGACAAGG - Intronic
1158491231 18:57911321-57911343 GGGAACTGCCTGAAGTCCCATGG - Intergenic
1159033518 18:63255361-63255383 GGGGACTGGCCTATGTCCCAGGG + Intronic
1161353729 19:3807439-3807461 GAGGACTCCCCCATGTGCCCGGG - Intronic
1162107047 19:8376087-8376109 GAGCACTGCCCCATGCTCCATGG + Intronic
1163791402 19:19308498-19308520 GGGTACCACCCCGTGTGCCAGGG - Intronic
1164011867 19:21210614-21210636 GGAAACTGCCCCACATGCCGAGG + Intergenic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1164061364 19:21678203-21678225 GGGAACTGCCCCGCATGCCGAGG - Intergenic
1164065291 19:21709509-21709531 GGGAACTGCCCCGCATGCCAAGG + Intergenic
1165164295 19:33840599-33840621 GTGAACAGCCCCACCTGCCAGGG - Intergenic
1167747062 19:51358106-51358128 GGGAGCTGCCCCATTTGGCCTGG + Intronic
1167876799 19:52420629-52420651 AGGCACTGACCCATGGGCCAGGG + Intergenic
925150001 2:1608490-1608512 GGCGAATGCCCCATGTGCCCTGG + Intergenic
925219528 2:2126735-2126757 CAGAAGTGCCCCAAGTGCCAAGG + Intronic
926197304 2:10771742-10771764 GAGAACTGCCCCCAGTGCCCGGG + Intronic
928370169 2:30734762-30734784 GAAAACTGCCCTATGTGTCAGGG - Intronic
929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG + Intronic
930006170 2:46898826-46898848 GCCAACTGGCCCATGTGGCATGG + Intergenic
931102309 2:59015756-59015778 GGGACCTGCCCTATCTGCCTAGG + Intergenic
931976234 2:67646896-67646918 GGCAGCTGCCCTATGTGACAAGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933997443 2:87680152-87680174 GGGAACTGAGCCATGTGCAGTGG - Intergenic
934928271 2:98397197-98397219 GGGAACTTCCCCATCAGCCAGGG - Exonic
936287815 2:111194602-111194624 GGGCACTGACCGAGGTGCCAGGG + Intergenic
936296409 2:111270760-111270782 GGGAACTGAGCCATGTGCAGTGG + Intergenic
936607231 2:113970756-113970778 GAGAACTGCACCATGTGTCTAGG + Intergenic
939262601 2:139829602-139829624 GGGACTTGCCCCATCTGCCTAGG + Intergenic
941675451 2:168339226-168339248 AGGAAGGGCCCCATGTTCCACGG + Intergenic
944481641 2:200163455-200163477 GGGAAATGCCCTCTGTGCCTAGG - Intergenic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
947170008 2:227301265-227301287 GAGAGCTGTGCCATGTGCCATGG - Intronic
947334729 2:229069610-229069632 GAGAAATGCCCCATGTGTGAAGG + Intronic
948219538 2:236258635-236258657 GGGATATGGCCCATGTGTCATGG + Intronic
948432716 2:237930233-237930255 GGGTTCTGCCCCATCTGCCTAGG - Intergenic
948684971 2:239664613-239664635 TGGAACTGTCCCCTGTGCCCCGG + Intergenic
1171017730 20:21557101-21557123 GTGAACTGTACCATGTACCATGG + Intergenic
1171272479 20:23827654-23827676 GCCACCTGCCACATGTGCCACGG - Intergenic
1172363559 20:34331990-34332012 GGGACCTGCCCCGTCTGCCTAGG - Intergenic
1173251696 20:41366978-41367000 GGGAGCAGCCCCAGGTGGCAGGG + Intergenic
1173813203 20:45968777-45968799 GGGTACAGCACCATGTGTCACGG + Intronic
1174188344 20:48722730-48722752 GGCAACTGCCCCCTGAGACAGGG + Intronic
1175250851 20:57609417-57609439 GGGAAGTGCCGCCTGTGTCAAGG - Intronic
1176171018 20:63696446-63696468 GGGAGCTGCCCCAGGTGCTGAGG + Intronic
1176229342 20:64023828-64023850 GGGCACTGCCCACTGTGCCCAGG - Intronic
1176989420 21:15477485-15477507 GTGAACTATCCCATGTGTCAGGG - Intergenic
1177900876 21:26913755-26913777 GGGACCTGCCCCATCAGCCTAGG - Intergenic
1178017796 21:28371003-28371025 TGAAAATGCTCCATGTGCCAAGG + Intergenic
1178476628 21:32943125-32943147 GGGAAATGCCCCACTTTCCAGGG - Intergenic
1178779412 21:35587514-35587536 GGGAAATGCCCTCTCTGCCATGG + Intronic
1179097015 21:38325045-38325067 GGGATCTGCACCATGGGGCAGGG + Intergenic
1179160635 21:38894200-38894222 GGGAAATGCCCCATCTTACATGG - Intergenic
1181345783 22:22219702-22219724 GGGAACTGCCCCAGGTCTCTAGG - Intergenic
1181412509 22:22734239-22734261 GGGCACTGTGCCATGTGCCCAGG + Intergenic
1184136281 22:42551787-42551809 GGGAAGGGCCCCCTGTCCCATGG - Intergenic
1184851759 22:47125091-47125113 GGGCGCTGCCCCATGGGCCTGGG - Intronic
1184889251 22:47369395-47369417 GGCTTCTGCCCCATCTGCCATGG + Intergenic
949930453 3:9074358-9074380 GGCAGCAGCCCCATGTTCCAGGG + Intronic
950254445 3:11492981-11493003 GGCATCTGCCCCATGTGACAAGG - Intronic
950511586 3:13431636-13431658 GGTAACTTCCTGATGTGCCATGG + Intergenic
952016105 3:28959071-28959093 GGGAACCGCCCCTTCTGCCCAGG - Intergenic
953466558 3:43126752-43126774 GGGAACTGACTCATCTGCCTTGG + Intergenic
954737892 3:52721893-52721915 GGAACCTGCCCCATCTGCCTAGG - Intronic
955531944 3:59882713-59882735 GGGAGCAGCACCATTTGCCAGGG - Intronic
956163697 3:66380654-66380676 GGGTCCTGCCCCGAGTGCCAAGG - Exonic
956992752 3:74787174-74787196 GGGAACTGCTCCTGTTGCCATGG + Intergenic
957013028 3:75029576-75029598 GTGAATTGGGCCATGTGCCAGGG - Intergenic
959738171 3:109685136-109685158 AGGAACTGACCCATGGGCCGGGG - Intergenic
960655393 3:119998333-119998355 GTGAACAGGCCCATGTGGCAAGG + Intronic
960719957 3:120616202-120616224 GGGGGCTCCCCCAAGTGCCATGG + Intergenic
962687766 3:137863636-137863658 GGGAACTGCCCCATCTCACAAGG + Intergenic
963397941 3:144757218-144757240 GGGCACTGCCCCCTGCTCCATGG + Intergenic
965587025 3:170327747-170327769 GGGCACTGCCCCCTGCTCCATGG + Intergenic
965846590 3:172969371-172969393 TGGGACTGCCCTATGTGCAAAGG - Intronic
967215968 3:187210747-187210769 GGGTACTGCCACATGCACCAGGG + Intergenic
968829561 4:2925926-2925948 GCGGGCTGCCCCATCTGCCATGG + Intronic
974129392 4:57734525-57734547 TGGAACTGCCCCATATGGGAAGG + Intergenic
974299197 4:60042259-60042281 GGGCACTGCCCCCTGCTCCATGG - Intergenic
975391035 4:73817537-73817559 GGGAACTGTCCAAGGTGACAGGG + Intergenic
976050293 4:81004030-81004052 GGAAATTGCCCCCTGGGCCAAGG + Intergenic
978216250 4:106208183-106208205 GGGACTTGCCCCATCTGCCTAGG - Intronic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
982348590 4:154389290-154389312 TGGATCTGGGCCATGTGCCATGG + Intronic
985145476 4:186890438-186890460 GAGCGCTGCCCCATGTTCCACGG + Intergenic
986076170 5:4340250-4340272 GGCAGCTGCCCCATGTGACGAGG - Intergenic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
987230819 5:15891977-15891999 GGGAACAGCCCCAGGTTGCAAGG + Intronic
987327942 5:16829220-16829242 GGGAAGGGCCCCCTGTGCCCTGG + Intronic
989395517 5:40951757-40951779 GGACACTGACCCATGTGTCATGG + Intronic
991639219 5:68736854-68736876 GGGAACTGCCACATGAGGCTTGG - Intergenic
995123165 5:108556575-108556597 GGGAACAGCGCCATGTGGCAGGG - Intergenic
995898854 5:117046243-117046265 GGGCACTGCCCCATCTGCCAGGG - Intergenic
997047604 5:130337679-130337701 GGGAGCTTCCCCTGGTGCCAGGG - Intergenic
998263358 5:140647955-140647977 GCCAAGTGCCCCAAGTGCCATGG - Intronic
1000085919 5:157887167-157887189 GGGCACTGCCCCCTGCTCCATGG + Intergenic
1000636067 5:163645096-163645118 GGGACCTGCCCCATCTGCCTAGG - Intergenic
1004228634 6:13811653-13811675 CTGGACTGCCCCATGTGTCAGGG + Intronic
1005707851 6:28473836-28473858 AGGTACTGCTCCAAGTGCCAGGG - Intergenic
1005799450 6:29405692-29405714 TGAAACTGCCCCATCTGGCAAGG + Intronic
1005893715 6:30160797-30160819 GTCAACTGCCCCATCTGTCAGGG - Exonic
1007114744 6:39335627-39335649 AAGAACTGCCCCCTGGGCCAGGG - Exonic
1011408819 6:87044388-87044410 GACAACTGCCCCATGTGACAAGG + Intergenic
1012131340 6:95497266-95497288 GGGCACTGCCCCTTGCTCCATGG + Intergenic
1016199978 6:141395009-141395031 GGGACCTGCCCCTTCTGCCCAGG - Intergenic
1017541345 6:155406044-155406066 GGCAACTGGAGCATGTGCCAAGG - Intronic
1019414787 7:922251-922273 AGGAAGTGCCCCAAGTTCCAGGG + Intronic
1021103604 7:16611895-16611917 GGAAAGTGCCCCATGTGCCTGGG - Intronic
1026980045 7:74521097-74521119 GGTAACAGCCTCATCTGCCAGGG - Intronic
1027616836 7:80434063-80434085 GGCAGCTGCCCCATGTGCTGAGG + Intronic
1028058680 7:86282188-86282210 GGGAACCGCCCCCTGCTCCAGGG - Intergenic
1031173994 7:118325611-118325633 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1031667626 7:124504149-124504171 GGGACCCGCCCCATCTGCCTAGG + Intergenic
1032031456 7:128487142-128487164 GGGAACTGCAGCATTTGCTATGG - Intronic
1032784389 7:135188839-135188861 TGTAACTTCCCCATGTGCCCTGG + Intronic
1034717317 7:153255666-153255688 GGCACCTGCCCCATCTGCCTAGG - Intergenic
1038520302 8:28226655-28226677 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1043506211 8:80905786-80905808 AGGCACTTACCCATGTGCCAGGG + Intergenic
1043951306 8:86311880-86311902 GGCAGCTGCCCCACGTGACAAGG + Intronic
1044403141 8:91795008-91795030 GAGAACTTCCCCATCTGGCAAGG + Intergenic
1049465774 8:142750673-142750695 GGGAACTGCCCCATCAGGCCGGG - Intronic
1049568387 8:143355652-143355674 GGCATCTCCCTCATGTGCCAGGG - Intronic
1051121881 9:13760597-13760619 GGGTAATGCCCCATAAGCCAGGG + Intergenic
1055764542 9:79648259-79648281 GGGAACTGAGCTAGGTGCCAGGG + Intronic
1056084112 9:83128250-83128272 GGGATCTGCCCCATCTGCCTAGG - Intergenic
1056110303 9:83388504-83388526 GGGACCCACCCCATGAGCCAGGG + Intronic
1056475080 9:86945838-86945860 GGGACCTGCCCTATGGGCCTGGG - Exonic
1056626841 9:88260734-88260756 GGGAATGGCCCCAGGTGGCACGG + Intergenic
1060533395 9:124363189-124363211 GGGAATTGCCCCATTTGGTAGGG - Intronic
1061193656 9:129095972-129095994 GGCCACTGCCCCAGGTGCCCCGG - Intronic
1061392810 9:130327228-130327250 GGGAGCTGCCCCATGGCCCAGGG + Intronic
1061941949 9:133888515-133888537 GGAAACTGCCCCATGACCCAGGG - Intronic
1062238294 9:135523048-135523070 GGGAACTGCCGCATGGGACCCGG + Intronic
1188301380 X:28507982-28508004 GAGAACTGACTCATGTACCAAGG - Intergenic
1190705544 X:53023880-53023902 GGGACCCGCCCCATCTGCCTAGG - Intergenic
1192967180 X:76190870-76190892 GAAAACTGCCCCATTTGCAATGG - Intergenic
1192973004 X:76253382-76253404 GGGAACTTCTCCATCTACCAAGG - Intergenic
1193185126 X:78502473-78502495 GAGACTTGCCCCATGTCCCATGG - Intergenic
1197174595 X:123471853-123471875 GGGATCAGCCTCATGTGCCAAGG - Intronic
1200154765 X:153969559-153969581 GGGAACTGACCCTTGTGCTAGGG + Intronic