ID: 1164035847

View in Genome Browser
Species Human (GRCh38)
Location 19:21454268-21454290
Sequence TTGTGCAAATGTAATAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 1, 2: 5, 3: 40, 4: 405}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164035847_1164035852 10 Left 1164035847 19:21454268-21454290 CCAAATTTATTACATTTGCACAA 0: 1
1: 1
2: 5
3: 40
4: 405
Right 1164035852 19:21454301-21454323 ATGGAACTTTGTTCCACAGAAGG 0: 8
1: 66
2: 102
3: 98
4: 211
1164035847_1164035848 -9 Left 1164035847 19:21454268-21454290 CCAAATTTATTACATTTGCACAA 0: 1
1: 1
2: 5
3: 40
4: 405
Right 1164035848 19:21454282-21454304 TTTGCACAATTTTTCCCCGATGG 0: 1
1: 0
2: 0
3: 1
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164035847 Original CRISPR TTGTGCAAATGTAATAAATT TGG (reversed) Intronic
900618525 1:3576419-3576441 TTGTTCAAATGAAATAATTTGGG + Intronic
902090706 1:13900757-13900779 TTGTGCAAATGAGAAAAATGTGG - Intergenic
904874426 1:33643315-33643337 TTTTGCACATGTAATAAGTGTGG - Intronic
905009885 1:34740099-34740121 TTGTGCCAATGGAACAAATGAGG + Intronic
906398772 1:45489838-45489860 TTGAGAGAAGGTAATAAATTTGG - Intronic
909034281 1:70579552-70579574 TTGTGGAAAGGAAATAAATAAGG - Intergenic
910756009 1:90691662-90691684 TTGTGTACAAGTAGTAAATTGGG - Intergenic
911502205 1:98701535-98701557 TTGTACATATGTACTACATTTGG - Intronic
912176378 1:107162936-107162958 ATGTGTAACTGTAATAAATTTGG + Intronic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
913092546 1:115488713-115488735 AGGTGCAAATCTAACAAATTTGG + Intergenic
916339537 1:163714259-163714281 TTTTGCACATTTAAAAAATTAGG + Intergenic
917049811 1:170908272-170908294 CTGTATAAATGTAATAAATGTGG + Intergenic
918567796 1:185952553-185952575 ATGGGCAAATGTCATAAAATGGG - Intronic
919089279 1:192958347-192958369 TTTTGCAAATGTAACATACTTGG - Intergenic
919113065 1:193244044-193244066 TAGTGAAAAAGTAAAAAATTGGG + Intronic
922245882 1:223797096-223797118 TAGTGAAAATGGAATAATTTGGG - Intronic
922631500 1:227118102-227118124 TTGGCCAAAAGTAATAAATCTGG + Intronic
923897805 1:238292483-238292505 TTATGCAAATGTGACATATTTGG + Intergenic
924316198 1:242800044-242800066 TTGTGCAAATCAATTAATTTGGG - Intergenic
924684241 1:246271283-246271305 TTATGAAAATTTAAAAAATTTGG - Intronic
924764258 1:247017144-247017166 CTCTACAAATGTAATAAATGTGG + Intergenic
924897003 1:248349804-248349826 TGGTGTAAATTTAATAAATAAGG + Intergenic
1064476579 10:15696570-15696592 TAGAGCAAATGTTATTAATTTGG - Intronic
1065069624 10:22009372-22009394 GGGTGCAAATGTAATCAATCTGG - Intergenic
1065691493 10:28338559-28338581 TCCTGCAAATGTAAGTAATTTGG - Intergenic
1066665294 10:37777019-37777041 TTTGGCATATGTAAAAAATTTGG - Intronic
1066783940 10:38981044-38981066 TTGTTCAAAGATAAAAAATTTGG + Intergenic
1067394510 10:45901775-45901797 TTGAGCGACTGAAATAAATTAGG + Intergenic
1067862833 10:49870906-49870928 TTGAGCGACTGAAATAAATTAGG + Intronic
1068701762 10:60027829-60027851 TTGTACAAATATAAGAAATGAGG + Exonic
1069019462 10:63469674-63469696 TTGTTAAAATGCATTAAATTTGG - Intergenic
1071025680 10:81110136-81110158 ATGTGGGAATCTAATAAATTGGG - Intergenic
1071122441 10:82295176-82295198 TAGTTCAACTGTTATAAATTTGG - Intronic
1071149585 10:82618614-82618636 ATGAGCAAATGAAATAAATATGG + Intronic
1071685447 10:87750080-87750102 TTGTGCAAATGAAATCTCTTAGG - Intergenic
1072398050 10:95065690-95065712 TTGCCCAAATGAATTAAATTTGG - Intronic
1073724333 10:106212352-106212374 TGGTGTAGATGCAATAAATTAGG + Intergenic
1073738989 10:106384487-106384509 GTATGCAAATCTAATAAAATGGG + Intergenic
1074892230 10:117745236-117745258 ATGTGCAAACCTAATACATTGGG - Intergenic
1075549177 10:123379512-123379534 TTGGGCAAAAGGAATAAATTAGG - Intergenic
1075767318 10:124903962-124903984 TTGTGGAAATGTAAACAATTTGG - Intergenic
1076658077 10:132037391-132037413 GTCTGCAAATGTAAGAAATGGGG + Intergenic
1078299282 11:10109123-10109145 TTTTGCATATGTATTTAATTTGG - Intronic
1078504544 11:11924463-11924485 TTGGGCTCATGTAATAAGTTAGG + Intronic
1078844505 11:15109146-15109168 TTGAGCAAACGCTATAAATTAGG - Intergenic
1079659958 11:23024482-23024504 TATTGAAAATTTAATAAATTAGG - Intergenic
1079906215 11:26250755-26250777 ATGTGCATATGTACAAAATTTGG - Intergenic
1080145103 11:28972723-28972745 TACTGGAAATGTAATAAAATAGG - Intergenic
1080478024 11:32616185-32616207 TTGAGCAAATGTGATAAATGTGG + Intronic
1081540105 11:44028540-44028562 TGGAGCAGCTGTAATAAATTTGG - Intergenic
1081741818 11:45446269-45446291 TTGTGCAAATTTAAAAAAGATGG + Intergenic
1083346069 11:61993266-61993288 TGGTGCAAAAGTAATTACTTTGG - Intergenic
1084391589 11:68880760-68880782 TTATGCTAATGAGATAAATTAGG - Intergenic
1086216508 11:84388541-84388563 TTGTGAAATTTGAATAAATTAGG - Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086516065 11:87614810-87614832 TTGTGATAATAAAATAAATTGGG - Intergenic
1087149035 11:94841763-94841785 AAGTGCATATGTAATAAACTTGG + Intronic
1087246433 11:95843678-95843700 TTTTGCAAATTTAATGAGTTTGG - Intronic
1088679703 11:112228468-112228490 GTGAGCTAAAGTAATAAATTGGG + Intronic
1090201439 11:124860649-124860671 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090705458 11:129332275-129332297 CTATGCAAATAAAATAAATTTGG - Intergenic
1090750497 11:129742785-129742807 ATTTGCAAATGTCATAAACTGGG - Intergenic
1092455020 12:8635409-8635431 TTGTGCAAGAAGAATAAATTTGG + Intergenic
1092664168 12:10776132-10776154 ATGTGCATTTGAAATAAATTGGG - Intergenic
1092978323 12:13768050-13768072 TAGTGCATATTTAATAAATAAGG - Intronic
1092980282 12:13787889-13787911 TTGATCCAATGTAATAAATGGGG + Intronic
1093379520 12:18475801-18475823 ATGTGAAAATGTAATTACTTAGG + Intronic
1095288426 12:40444869-40444891 TTAAGCAAAAGTAATATATTCGG - Intronic
1095292844 12:40495405-40495427 TTATGCAAATGTAAACAAATTGG + Intronic
1095629787 12:44362131-44362153 TTTTGCAAAGGAAATAAACTAGG - Intronic
1097296440 12:57968630-57968652 CCCGGCAAATGTAATAAATTTGG + Intergenic
1097379256 12:58875580-58875602 TTGTGCAAATGAAATGAAGATGG - Intronic
1098901397 12:76115431-76115453 GTTTGCAAATGCAATGAATTGGG - Intergenic
1099142085 12:78990744-78990766 TTCTGAAAATGTAATAAAGAAGG + Intronic
1099339486 12:81410297-81410319 TTGAGCCAATGTTACAAATTAGG - Intronic
1099404241 12:82240631-82240653 ACGTGGAAAGGTAATAAATTGGG - Intronic
1099678927 12:85798977-85798999 TTGTGTTACTGTCATAAATTAGG - Intergenic
1099705336 12:86145389-86145411 TTGTGCAAGAAAAATAAATTGGG + Intronic
1099868300 12:88313339-88313361 TGGTGGGAATGTAAAAAATTAGG + Intergenic
1103265017 12:119622339-119622361 TTGTGAACATGTAAAACATTTGG - Intronic
1104135101 12:125930447-125930469 TTGTGAAAATTAAATAACTTTGG - Intergenic
1104136591 12:125945625-125945647 TTGTGAAAATAAAATTAATTAGG + Intergenic
1104186674 12:126439453-126439475 TTTTCCAAAGGTATTAAATTAGG + Intergenic
1104207517 12:126654118-126654140 TTTTCCAAATGTCTTAAATTGGG - Intergenic
1105754309 13:23451117-23451139 GTGTGCAAATGTGATAAAGGAGG - Intergenic
1106003938 13:25751071-25751093 CTGTGCAAATGTGATTTATTTGG + Intronic
1106008832 13:25798205-25798227 TAGTGCAAATGAAACAAACTTGG - Intronic
1106225273 13:27781236-27781258 CTGTGAAAATAAAATAAATTAGG + Intergenic
1107924218 13:45242666-45242688 TAGTCCACATGTATTAAATTAGG + Intronic
1108504624 13:51101019-51101041 ATGTATAAATGTACTAAATTTGG - Intergenic
1108943736 13:55993818-55993840 TTGAGCATACGTAATAATTTAGG - Intergenic
1109115340 13:58375401-58375423 TTGTGAAAATTGAATAAGTTGGG - Intergenic
1109473518 13:62844668-62844690 TTGTGTAAAAGTACAAAATTAGG - Intergenic
1109946471 13:69439809-69439831 TTGTGCTCATCTAATAATTTTGG + Intergenic
1110113969 13:71787843-71787865 TTGTTCAGCTGTAGTAAATTTGG - Intronic
1110170778 13:72497838-72497860 TTAAACAAATGTAAGAAATTAGG + Intergenic
1111272731 13:85908489-85908511 TTGTGCTGATGTTATCAATTAGG + Intergenic
1111308638 13:86450663-86450685 TTATGCTAATGAAATGAATTAGG - Intergenic
1112321505 13:98411964-98411986 TTGTGCAAAGGTTCAAAATTCGG - Exonic
1112965692 13:105190368-105190390 TTGGGGAAATGTAATAAACAAGG - Intergenic
1113154080 13:107298048-107298070 TTGGGCAAATTTAATAGATCAGG + Intronic
1113529357 13:111009699-111009721 TTAAGAAAATGTAATAAAGTTGG + Intergenic
1114838019 14:26226953-26226975 TAAAGCAGATGTAATAAATTTGG - Intergenic
1115606629 14:35009547-35009569 TTGTGAAAATGTAGTGAAATAGG + Intronic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116394930 14:44436305-44436327 ATGAATAAATGTAATAAATTGGG - Intergenic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1116959842 14:50957710-50957732 TGATGAAAATGTAAGAAATTTGG - Intergenic
1117096595 14:52304901-52304923 TTGTGTAAATATAATAATTATGG + Intergenic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1117961467 14:61166885-61166907 TTGTTCAAATCTGTTAAATTTGG + Intergenic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1120494368 14:85215961-85215983 TGGTGTAAATGTGATAATTTGGG - Intergenic
1122028723 14:98896915-98896937 TGGTGCAAATGTTCTAAAATTGG - Intergenic
1123951707 15:25284880-25284902 CTGTCCAAATGGAATAAGTTGGG - Intergenic
1124552672 15:30696170-30696192 TTGTGCAAATGTAAAACTCTTGG + Intronic
1124678570 15:31709500-31709522 TTGTGCAAATGTAAAACTCTTGG - Intronic
1126002501 15:44224250-44224272 TTGTGGGAATTTAATAAATGAGG - Intergenic
1126749599 15:51863445-51863467 GTCTGGAAATGTAATCAATTCGG - Intronic
1126962843 15:54017293-54017315 TTATGCAAATGTAATGCATATGG + Intronic
1127481190 15:59378909-59378931 TTCTCCAAATCTAAAAAATTTGG + Intronic
1127574833 15:60281199-60281221 CTGTGGAATTGTAATAAAATGGG - Intergenic
1129533121 15:76285523-76285545 TTTTTCAAATGTAAGAAGTTGGG - Intronic
1130609295 15:85346336-85346358 TCCTGCAATTGTAATTAATTGGG - Intergenic
1130837556 15:87665554-87665576 TTGTGAAAATGTAAACAATTTGG + Intergenic
1131467233 15:92665507-92665529 CTGTGCAAATGTAACTGATTTGG - Intronic
1131891773 15:96979776-96979798 TTATTCCAATATAATAAATTAGG + Intergenic
1133693624 16:8239660-8239682 GTGTGCATATGTAATATGTTGGG + Intergenic
1133730140 16:8571818-8571840 TTGGGCAAAGGTAATACATGCGG + Intronic
1134364083 16:13560732-13560754 CTGTCCAAATGCACTAAATTAGG + Intergenic
1134753943 16:16649842-16649864 TTGTGCAAATGTTATTGTTTGGG - Intergenic
1136315285 16:29451343-29451365 TTGTGCCATTGTACTCAATTTGG - Intronic
1136429862 16:30190685-30190707 TTGTGCCATTGTACTCAATTTGG - Intergenic
1137062657 16:35805913-35805935 TTGTAAAAATCTTATAAATTAGG - Intergenic
1137869059 16:51932002-51932024 TGGTGTAAATGGAATAAAATCGG - Intergenic
1140552105 16:75877609-75877631 TTGTGGAAAAGTAGTAACTTTGG - Intergenic
1140571751 16:76115344-76115366 ATATGCAAAGGAAATAAATTTGG - Intergenic
1140589884 16:76338845-76338867 TTGTGAAAATCAAACAAATTAGG + Intronic
1140721683 16:77777764-77777786 TTGTCAAAATTTTATAAATTTGG + Intergenic
1141027897 16:80565115-80565137 TGGTGCAGATGTAATTAGTTAGG - Intergenic
1141117623 16:81324150-81324172 TTCTGTAAATGTGATTAATTGGG - Intronic
1141283505 16:82650197-82650219 TTCAGCAATTGTAATAAATGAGG + Intronic
1145778487 17:27545913-27545935 TTGTGCAAATGGCATATGTTAGG + Intronic
1146195050 17:30804723-30804745 TTGTGCAAATGAATCACATTTGG - Intronic
1149073014 17:52565737-52565759 TTTTAAAAATTTAATAAATTTGG + Intergenic
1149756218 17:59188411-59188433 TTGTACATATGTACAAAATTTGG - Intronic
1151327308 17:73387264-73387286 TTTTTTAAATGTAGTAAATTAGG + Intronic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1153152830 18:2114233-2114255 TTATTCAAATGTAATAATGTTGG - Intergenic
1153874076 18:9350221-9350243 ATGTTCAAATGTAATGAGTTAGG + Intronic
1153904229 18:9646819-9646841 TTGTGCAAATGCAAAGAAGTAGG + Intergenic
1154034096 18:10781644-10781666 TTATGAAAATGTAATAATATAGG - Intronic
1154314132 18:13290610-13290632 TCTTGCACATGTAAAAAATTAGG + Intronic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156135900 18:34037063-34037085 TTCTGCAATTCTACTAAATTTGG - Intronic
1156917409 18:42478037-42478059 TTTTGCAAATGAAAAAAACTAGG - Intergenic
1157049746 18:44148888-44148910 TTGTACAAATGTAGAAACTTTGG + Intergenic
1157128424 18:44979871-44979893 TTTTGTAAATGTATTAAATGAGG - Intronic
1158149605 18:54353077-54353099 TTGTCCAATGGTAAAAAATTGGG + Intronic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159826425 18:73217911-73217933 GTGTGCACATGTAATATATAGGG + Intronic
1160063606 18:75553869-75553891 TTGTGGAAATGTAATTTAATGGG + Intergenic
1160238715 18:77106839-77106861 TTGTCCAATTTAAATAAATTGGG - Intronic
1160574886 18:79847662-79847684 TTTTTCAAATGTAATCAATAAGG - Intergenic
1160761839 19:789407-789429 TTCTGCAGATGTAATTAGTTAGG - Intergenic
1161876757 19:6917775-6917797 AAGTCCAAATGTAATAAACTGGG - Intronic
1162607619 19:11722902-11722924 TCGTGCAAATGAAATAAACTGGG + Exonic
1162686666 19:12391751-12391773 TCATGCATATGTAATAAACTGGG + Exonic
1162691017 19:12431525-12431547 TCATGCATATGTAATAAACTGGG + Exonic
1163087779 19:14994649-14994671 TTGTGAAAGTAAAATAAATTTGG + Intronic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163902782 19:20120488-20120510 TCCTGCAAATGTAGTGAATTTGG + Intronic
1163911586 19:20199400-20199422 TCCTGCAAATGTAATGAGTTTGG + Exonic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164045783 19:21539030-21539052 TCCAGCAAGTGTAATAAATTTGG + Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164075144 19:21809414-21809436 TTCTGCAAATGTGAAAAATGTGG - Exonic
1164092373 19:21969602-21969624 CCCTGCAAATTTAATAAATTTGG - Intronic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164154531 19:22582865-22582887 TTGAGGAAATTAAATAAATTAGG + Intergenic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164223614 19:23221430-23221452 CTCTGCAAAGGTAGTAAATTTGG - Intergenic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287596 19:23833933-23833955 CCCTGCAAATATAATAAATTTGG + Intergenic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1167990209 19:53353915-53353937 TTTTGAAAGTGTAATAAATGTGG + Exonic
928647834 2:33373954-33373976 TTTTGCAAAAGTAAAGAATTTGG + Intronic
928897991 2:36286642-36286664 TTGTGCAAATGGCTTACATTTGG - Intergenic
929236395 2:39609720-39609742 TAGTGCAACTGAAATAAAGTTGG - Intergenic
929323414 2:40575363-40575385 TTGACCACATGAAATAAATTGGG + Intronic
929347976 2:40910022-40910044 TTATCCAAATGTAAGAAAATGGG - Intergenic
930327273 2:49935721-49935743 CTGAGCAAATGTAATTAATGAGG + Intronic
930485155 2:52002181-52002203 TTTTGTAAATGCAATAAATAAGG - Intergenic
931158898 2:59666451-59666473 TTGTGCAATATAAATAAATTTGG + Intergenic
931419031 2:62108819-62108841 TTGTGCAAATAAAATAAAATTGG + Intronic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
933015822 2:77125755-77125777 TTTTTCAAATTCAATAAATTAGG - Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934510820 2:94940793-94940815 TTGAGTAACTGAAATAAATTAGG + Intergenic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
935193525 2:100796996-100797018 TTGTGCAAACAGAATAATTTAGG + Intergenic
936634775 2:114243547-114243569 GTGTGCAAATCAAATAAATGAGG - Intergenic
937183560 2:120017498-120017520 TTGTGCAAATGAAACACATGAGG + Intronic
938785518 2:134625018-134625040 TTGTTAAAATGTAATATACTAGG - Intronic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
939717541 2:145603404-145603426 TTGTTCAAATCTCTTAAATTTGG - Intergenic
940127496 2:150343387-150343409 TGGTCCAAATTTAATAGATTTGG - Intergenic
940263980 2:151817270-151817292 TAGTGCACATGTAAATAATTAGG - Intronic
940333142 2:152497393-152497415 TTGTTCATTTGTAATACATTAGG + Intronic
941703795 2:168635655-168635677 TTTTAAAAATGTAATAAAATAGG - Intronic
941849732 2:170167595-170167617 TTATTCAAATGTCATCAATTGGG - Intergenic
942437819 2:176000301-176000323 TTTTGCAAATGCAATAACTGAGG - Intronic
943486865 2:188495993-188496015 TTGTGCAAATCTATTCAATTTGG - Intronic
943894785 2:193342481-193342503 CTGTGCAAATGCAATCAACTGGG - Intergenic
945343652 2:208687048-208687070 TTTTCCAAATAAAATAAATTAGG + Intronic
945813005 2:214570772-214570794 TTGTGAAAATGTGATAAAATTGG - Intronic
946547020 2:220754988-220755010 ATGGACAAATGAAATAAATTAGG + Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947945759 2:234100737-234100759 TTTTGGAAATGTAATATTTTTGG + Intergenic
948228605 2:236333454-236333476 TTGTTTAGATGTTATAAATTTGG - Intronic
1168899190 20:1346262-1346284 TTTTGCCCATGTAAAAAATTAGG + Intronic
1169157640 20:3346645-3346667 TTGTGCAAATGAAATAGAAAAGG + Intronic
1169671529 20:8107870-8107892 TTTTGCAACTGTAACAAAATAGG - Intergenic
1169884233 20:10380838-10380860 TTTTGCAAATGAAATATGTTTGG - Intergenic
1169940233 20:10928942-10928964 TTGTGCAGATGTGGTAACTTGGG - Intergenic
1170074835 20:12408313-12408335 ATGTTGAGATGTAATAAATTTGG + Intergenic
1171727389 20:28637594-28637616 TTCTGCAAATAAAATAAAATTGG - Intergenic
1173133273 20:40414640-40414662 TCCTTCAAATGTAATAAAATTGG + Intergenic
1173359649 20:42330942-42330964 ATGTGCAAATGAAATAAGTTGGG - Intronic
1173753592 20:45495852-45495874 TGTTGCAAATGTAAGAAACTTGG + Intergenic
1174686689 20:52463089-52463111 CAGTGCACATGTCATAAATTAGG + Intergenic
1174946019 20:54986324-54986346 TTGTGCAAAATTAATAGATGAGG + Intergenic
1175456463 20:59118768-59118790 TTATCCAAATGTATTACATTCGG + Intergenic
1177036689 21:16053026-16053048 TTATGCACATGTATTTAATTTGG + Intergenic
1177189916 21:17839478-17839500 GTGTGCAAATATATTAATTTAGG + Intergenic
1177798590 21:25805246-25805268 TTGTGCAACTGTAATTATCTAGG + Intergenic
1177942626 21:27430031-27430053 CTGTGCAAAGGGAATAAATATGG - Intergenic
1178785504 21:35649613-35649635 TTGTGCAAAAACACTAAATTTGG + Intronic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
950027641 3:9831653-9831675 TTTTGCAACTCTAATAAAATAGG - Intronic
950204616 3:11069319-11069341 ATGTTTAAATGTAATAAAGTAGG + Intergenic
955039803 3:55304817-55304839 TTGGGCAAATGTAAGGGATTTGG + Intergenic
956303347 3:67796706-67796728 TTGAGCAAATGAATTAATTTAGG - Intergenic
956821905 3:72961584-72961606 TTGTGAAAATGTATTCACTTGGG - Intronic
956903690 3:73743511-73743533 TTGAACAATTGTTATAAATTTGG - Intergenic
957434724 3:80160141-80160163 CTGTGCACATGGAATAAATCAGG + Intergenic
957455370 3:80436465-80436487 TTTTCTAAAAGTAATAAATTAGG + Intergenic
957944392 3:87044061-87044083 TTGTGCAAATATAAGAAGTCTGG + Intergenic
958612077 3:96438233-96438255 TTGGGCAATTGTACTATATTGGG + Intergenic
958645523 3:96867269-96867291 TTGTGCAAATATTAACAATTTGG + Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959191279 3:103114070-103114092 TTTGGCAAATGTAATAGATAAGG + Intergenic
960267388 3:115636017-115636039 TTGAGCAAAAGTAACAATTTTGG - Intronic
960562623 3:119101722-119101744 ATTTGCAAATGTGAGAAATTAGG - Intronic
964468182 3:157021940-157021962 TTTTCCAAATGTATTACATTTGG + Intronic
964883344 3:161449336-161449358 CTGTGCTACTGTAATAATTTTGG + Intergenic
967429304 3:189363142-189363164 TTACACAAATGAAATAAATTAGG - Intergenic
967950934 3:194839977-194839999 TTGTGTAGATGTCATAAATTGGG - Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968409452 4:375380-375402 TCCTACAAATGTAATAAATGTGG + Intronic
968416543 4:441005-441027 TCCTACAAATGTAATAAATGTGG - Intronic
968871057 4:3242698-3242720 TGTTGCAAATGTGATTAATTTGG + Exonic
970634413 4:17991698-17991720 TTGTCTATTTGTAATAAATTTGG - Intronic
971881419 4:32379504-32379526 TTGTGCACATAAAATAAATTTGG + Intergenic
972058980 4:34844186-34844208 TTGAGCCAAGGTAATACATTCGG + Intergenic
974195433 4:58568422-58568444 TTCTAAATATGTAATAAATTGGG - Intergenic
975425478 4:74221232-74221254 ATGTGCAAATGGTATAAACTTGG - Intronic
975555132 4:75655617-75655639 TTGTGTATATGCAAGAAATTTGG - Intronic
976185823 4:82441823-82441845 TTAGGAAAATGTAATACATTAGG - Intronic
977197376 4:94080418-94080440 TTCAGCAAATGGAATAAAATTGG - Intergenic
977646659 4:99420478-99420500 TTGTGCATGTCTAATAACTTGGG + Intronic
977808775 4:101335240-101335262 TTTGGCAAATGTAGTAAAATTGG - Intronic
978022920 4:103835412-103835434 ATGTGTAAATGTAATCATTTAGG + Intergenic
978683058 4:111406138-111406160 ATGTGCAAATGTGTTAAAATTGG - Intergenic
979056589 4:116002704-116002726 TTGTGCAAATATAATCAAATTGG - Intergenic
979162766 4:117484770-117484792 TTGTACAAATAAAATAAAATAGG + Intergenic
979435678 4:120686621-120686643 ATGTGAAAATGTCATTAATTTGG + Intronic
979828513 4:125270547-125270569 ATGGACAAATGTAACAAATTAGG - Intergenic
980197398 4:129608407-129608429 TTCTGAAAATGTAATACTTTCGG + Intergenic
980511708 4:133799277-133799299 TTCTGCAAATTTACTAAGTTGGG - Intergenic
980538723 4:134164823-134164845 TTAAGCAAAAGTAATAAATCTGG + Intergenic
980543343 4:134224364-134224386 TTGATCATATTTAATAAATTAGG - Intergenic
980701649 4:136440336-136440358 TTGTACAGATGAAAAAAATTGGG - Intergenic
981036129 4:140170606-140170628 TTACGCATATGTTATAAATTTGG + Intergenic
981711828 4:147716463-147716485 TTGTTCAAATCTAAAAAACTTGG - Intergenic
981798048 4:148621042-148621064 TTCTGTTAATGTGATAAATTAGG - Intergenic
983492200 4:168400685-168400707 TTTTGCAAATAGAGTAAATTTGG - Intronic
984265246 4:177490524-177490546 TTTTGGATATGTAATAATTTGGG + Intergenic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
984808678 4:183774626-183774648 TTGTGGAAATGTATTTTATTTGG + Intergenic
985433216 4:189901453-189901475 TTCTGCAAATAAAATAAAATTGG + Intergenic
986229876 5:5853298-5853320 ATGTGCAAATGTACAAAATGAGG - Intergenic
987246017 5:16049671-16049693 TTGAGAAAATTTGATAAATTTGG + Intergenic
987934561 5:24447612-24447634 TAGTTCAAATGTAGTAAATGGGG - Intergenic
989430424 5:41348523-41348545 TTGTGCAAATATAATAATAAAGG + Intronic
989597948 5:43174327-43174349 TTCTGTAAATGTTATAAATATGG - Intronic
989726536 5:44593914-44593936 TTATGCAAAAATAGTAAATTTGG + Intergenic
990047678 5:51454576-51454598 TTGGGCACATGGAATATATTAGG + Intergenic
990065487 5:51709407-51709429 TTGTGCATATGGACTAGATTAGG + Intergenic
990290411 5:54345049-54345071 TTGTGAAAATAAATTAAATTTGG - Intergenic
990495119 5:56339429-56339451 TTGAGGAAATGTAAGAAACTCGG - Intergenic
991118202 5:62978959-62978981 TTGGGGAAATGTAAAAAATACGG + Intergenic
991200171 5:63982656-63982678 TTGTGCAAGTTGAATATATTAGG - Intergenic
991393636 5:66178615-66178637 TTTTGCAAATTTAAAAAACTGGG - Intronic
992654372 5:78893615-78893637 TTGCCAATATGTAATAAATTAGG - Intronic
993604262 5:89968893-89968915 TTGGGCAAAAGAAATAAATCAGG + Intergenic
996514339 5:124353241-124353263 ATAAGCAAATGAAATAAATTGGG + Intergenic
996647819 5:125838253-125838275 TTTAACAAAAGTAATAAATTTGG + Intergenic
996907589 5:128619343-128619365 ATGGGAAAAGGTAATAAATTAGG - Intronic
997917886 5:137947386-137947408 TTATGCAAATGTATTATCTTTGG - Intronic
1000830627 5:166096899-166096921 TTCTGCATCTGTAATTAATTCGG + Intergenic
1002349115 5:178570409-178570431 TTGGTCAAAAGTAAGAAATTAGG - Intronic
1003781030 6:9427067-9427089 TTGTACCAATGTAATATTTTTGG - Intergenic
1004563133 6:16770449-16770471 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1004609049 6:17221497-17221519 GTGTATAAAAGTAATAAATTGGG + Intergenic
1004758214 6:18636803-18636825 CTGAGCATATGTAAGAAATTGGG - Intergenic
1005140379 6:22625081-22625103 TTTTGCAAATTTCCTAAATTTGG - Intergenic
1007051000 6:38829504-38829526 TTGTGCATATGGTATAAGTTAGG + Intronic
1009515613 6:64613191-64613213 TTGTTCAAAAGTCATTAATTTGG - Intronic
1009542164 6:64974566-64974588 TTCTACAAATGTCAAAAATTTGG + Intronic
1009602239 6:65816680-65816702 TTGTGCAAACATCATAGATTGGG - Intergenic
1009830261 6:68920983-68921005 TTATGTATATGTAAAAAATTAGG + Intronic
1010041185 6:71386442-71386464 TTGTGCAAATGTAATCATGTGGG - Intergenic
1010413563 6:75588134-75588156 TTATGCAAATGATATAAAATTGG + Intergenic
1011962801 6:93112370-93112392 TTGTAAAAATGTACCAAATTGGG - Intergenic
1012213144 6:96549279-96549301 TTATGCAAATAAAATTAATTTGG - Intronic
1012341181 6:98125832-98125854 TTTTGCAAATGTCATTAATCTGG + Intergenic
1013586977 6:111588105-111588127 TTGTGCAAAAATAAAAACTTTGG - Intronic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014367912 6:120567585-120567607 TTATGCAAATATAATCATTTTGG + Intergenic
1014599542 6:123392805-123392827 TTGCTCAGATGTAATACATTCGG + Intronic
1015574970 6:134661499-134661521 TTGTGCAAATTTGATAAACTTGG - Intergenic
1017223856 6:151997155-151997177 TTGTGCAAATCTAGTTAATGGGG + Intronic
1017702243 6:157086031-157086053 TTATGGAAATGTATTATATTTGG + Intronic
1018375607 6:163208925-163208947 GGGGGAAAATGTAATAAATTTGG - Intronic
1018920756 6:168170993-168171015 TTGTGCATCTGTAAATAATTTGG + Intergenic
1019012363 6:168851948-168851970 TTGTGCAAATGAAATTTATCTGG - Intergenic
1020027357 7:4908455-4908477 TTGTAAAAATGTAATACATCTGG + Intronic
1020617320 7:10476156-10476178 TTGTGCAAATGTAAAAGGTCGGG + Intergenic
1020782879 7:12537970-12537992 TTGTCCACATGTAAGAAATCAGG + Intergenic
1020813918 7:12880718-12880740 TTCTGCAAATATAATAGATGGGG - Intergenic
1020907058 7:14076394-14076416 TTGTGCATTTGAAATAAAATTGG + Intergenic
1021107081 7:16649489-16649511 TTGTGCACATGTTACAAATTTGG + Intronic
1022376732 7:29820501-29820523 TTGTGCCCATGTAATTCATTTGG + Intronic
1023561629 7:41479864-41479886 TTGTCCTAGTGTTATAAATTAGG + Intergenic
1024014850 7:45304254-45304276 TTTTACAAATGTAACAAATGTGG + Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1024744690 7:52392561-52392583 CTGTGCATATGTAAAATATTAGG + Intergenic
1025623339 7:63195128-63195150 TTGTGCTTCTGTATTAAATTTGG + Intergenic
1025743049 7:64216435-64216457 TTGAGCAAAAATATTAAATTAGG + Intronic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025814287 7:64896310-64896332 TTCCGCAAATGAAATATATTTGG + Intronic
1025822151 7:64975959-64975981 AACTGCAAATGTAATATATTTGG - Exonic
1025867619 7:65400381-65400403 CCCTGCAAATGTAATAAATATGG + Exonic
1027729097 7:81846854-81846876 TTGTGCAAATGTAATAACGCAGG - Intergenic
1028064512 7:86365842-86365864 TTGGGCAAATTTGATAATTTAGG - Intergenic
1028590957 7:92494020-92494042 ATGTGAAAATATAATACATTAGG + Intronic
1030121646 7:106115718-106115740 TTGTACAATTTAAATAAATTTGG - Intergenic
1030525033 7:110642310-110642332 AACTGCAAATGTAAGAAATTGGG + Intergenic
1030577561 7:111309100-111309122 TTGTGAAATTGTCATAATTTGGG + Intronic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1030815990 7:114038327-114038349 TTTTGCAAATGAAGTAGATTTGG - Intronic
1032763100 7:134963650-134963672 TTATCCAAATGAAATTAATTAGG + Intronic
1033016102 7:137673149-137673171 TGTTGCAGATGTAATTAATTAGG - Intronic
1033266743 7:139893628-139893650 TGGTGCAAATGTAATTCAATGGG - Intronic
1033388886 7:140907234-140907256 TTTTGCAAATCTATTAAGTTGGG + Intronic
1036401985 8:8417142-8417164 TTGTTCAAATATGATAAACTGGG - Intergenic
1036494517 8:9257964-9257986 TTGTACAATTATAATAAAATGGG - Intergenic
1036982922 8:13491174-13491196 TTGTGAAAATGACATAAAGTTGG - Intronic
1036988395 8:13564093-13564115 TTTTGCAAAAGTAATAATATAGG - Intergenic
1037730648 8:21520728-21520750 TTGTCCAAAACTGATAAATTAGG + Intergenic
1038139628 8:24830169-24830191 TTGTGCAAATGACATGAGTTGGG - Intergenic
1039132241 8:34279360-34279382 TACTGCAAATGTAATGGATTTGG - Intergenic
1040592938 8:48812065-48812087 TTGTGCAGATGTTATCAAATGGG + Intergenic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1041216116 8:55602173-55602195 TAGTGCCAAAGTAATAAATGTGG - Intergenic
1041428228 8:57747888-57747910 TTGTGGAAATGTTATAAACTTGG + Intergenic
1041602929 8:59743054-59743076 CTGTGCAAATGTCACACATTGGG - Intergenic
1041782621 8:61594285-61594307 TTAAGCAAAATTAATAAATTCGG - Intronic
1042734006 8:71967533-71967555 TTGTACAAATTCAATCAATTTGG - Intronic
1043094910 8:75955503-75955525 TTGTCCAAATATAATAATATAGG - Intergenic
1043185452 8:77142628-77142650 TAATGCAAATGGAATAAATCAGG - Intergenic
1043567007 8:81559584-81559606 TTCTGCAACTATAATAAATCTGG + Intergenic
1043807134 8:84685487-84685509 ATGTGCAAATGTCCTAAATTGGG - Intronic
1043815691 8:84798474-84798496 TTTTGCAAATGAAATAATTGAGG + Intronic
1044591835 8:93920262-93920284 TTGAGAAAAAGTAATAAATTGGG - Intronic
1044592276 8:93925674-93925696 TTGTGGAAATGAAAGTAATTGGG + Exonic
1046842142 8:118871202-118871224 TAGTGCAAATGTGATAGAATGGG + Intergenic
1047163256 8:122405898-122405920 GTCTGCAGATGTGATAAATTTGG - Intergenic
1047197021 8:122730886-122730908 TTGTGGAAATGTAATCTATTTGG - Intergenic
1047811890 8:128419628-128419650 TTCTGCAAATATAGGAAATTTGG + Intergenic
1048309537 8:133309198-133309220 TTGTGAAAAATAAATAAATTAGG + Intergenic
1048471208 8:134705837-134705859 TTGGGCTATTTTAATAAATTGGG - Intronic
1050040937 9:1492723-1492745 TTCAGCAAATCTAATCAATTAGG + Intergenic
1050518788 9:6474932-6474954 TTGTGAAAATGTAATTATATGGG - Intronic
1050802803 9:9637180-9637202 GTGTGAAAATGACATAAATTTGG - Intronic
1051979723 9:22999266-22999288 TTGTACAAATTGAATAAATTGGG - Intergenic
1052141196 9:24986912-24986934 TTGTCTAAATGTAATATACTTGG + Intergenic
1052178554 9:25496333-25496355 CTGTGCAACTGGAATAAAATTGG - Intergenic
1052282361 9:26747873-26747895 TAATAAAAATGTAATAAATTAGG - Intergenic
1053174328 9:35911106-35911128 ATGTGCAAAAGTAATCAATTAGG - Intergenic
1053485537 9:38452338-38452360 TTGTGCAAAAGTAATTTAGTAGG - Intergenic
1053654564 9:40203557-40203579 TTGAGCGACTGAAATAAATTAGG - Intergenic
1053722352 9:40959509-40959531 TTCTGCAAATAAAATAAAATTGG + Intergenic
1053904955 9:42832764-42832786 TTGAGCGACTGAAATAAATTAGG - Intergenic
1054343617 9:63892489-63892511 TTCTGCAAATAAAATAAAATTGG - Intergenic
1054366679 9:64349774-64349796 TTGAGCGACTGAAATAAATTAGG - Intergenic
1054530031 9:66172753-66172775 TTGAGCGACTGAAATAAATTAGG + Intergenic
1054674308 9:67839516-67839538 TTGAGCGACTGAAATAAATTAGG - Intergenic
1055309097 9:74959912-74959934 TTGTCAAAATGTAATAAAAAAGG + Intergenic
1055465131 9:76558014-76558036 ATGTGCAAATGGAATAGATTGGG - Intergenic
1057000855 9:91507898-91507920 TTGTGCATAGGAAAAAAATTGGG - Intergenic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057165255 9:92920559-92920581 ATGTGCAAATGTTACAAATTGGG - Intergenic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1061240332 9:129367134-129367156 TTTTGAAAGTCTAATAAATTAGG + Intergenic
1185853708 X:3512663-3512685 TTATGCAACTGTATAAAATTAGG - Intergenic
1186066303 X:5769409-5769431 ATATGCAAATGGAATAAATGAGG + Intergenic
1186210212 X:7242943-7242965 TTGTGGAATTGAAATAGATTCGG + Intronic
1186800177 X:13084715-13084737 TTGTGCAAATAGCATTAATTGGG + Intergenic
1187205009 X:17173802-17173824 TTGTGAAAATGGAATAATTAAGG - Intergenic
1187656627 X:21482548-21482570 GTGGGAAAATGTAAGAAATTAGG + Intronic
1188081654 X:25849952-25849974 ATGTGCAAATCAAATGAATTTGG + Intergenic
1188574664 X:31632438-31632460 TTTTTAAAATGTGATAAATTAGG + Intronic
1189091552 X:38088675-38088697 TGGTGCACATTTAATAAATGTGG - Intronic
1193302695 X:79909863-79909885 TTTTGCAACTGTACTAAATAAGG + Intergenic
1194739296 X:97553268-97553290 TTGTGAATATTTAATTAATTAGG - Intronic
1195118140 X:101720495-101720517 ATCTACAAATGTAATAAATGTGG - Intergenic
1195376584 X:104233963-104233985 TTGTACAAATTTCATAAATGTGG + Intergenic
1196586166 X:117430850-117430872 TTGTTGAAATATAATAATTTAGG + Intergenic
1196965560 X:121051039-121051061 ATGAGCATATGTAACAAATTGGG - Intergenic
1197029194 X:121793506-121793528 TAATGCAAACGTATTAAATTAGG - Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1198591767 X:138190913-138190935 TTCTGCAAATCTATTAAAGTAGG - Intergenic
1199502597 X:148524545-148524567 TTATGAAAATGTTTTAAATTGGG - Intronic
1200652180 Y:5854235-5854257 GTGACCAAATGTAATAACTTTGG + Intergenic
1201610004 Y:15830565-15830587 TTGTACAAAAGTAAAAAAGTGGG - Intergenic
1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG + Intergenic