ID: 1164036688

View in Genome Browser
Species Human (GRCh38)
Location 19:21462005-21462027
Sequence TTGTGCCTGTGGAAGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164036685_1164036688 7 Left 1164036685 19:21461975-21461997 CCTCAATTCAAAGATGTCTGGGC 0: 1
1: 0
2: 0
3: 3
4: 128
Right 1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG 0: 1
1: 0
2: 3
3: 29
4: 247
1164036681_1164036688 30 Left 1164036681 19:21461952-21461974 CCAATAAAGTTTCCAAAGGAAAA 0: 3
1: 6
2: 7
3: 62
4: 603
Right 1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG 0: 1
1: 0
2: 3
3: 29
4: 247
1164036682_1164036688 18 Left 1164036682 19:21461964-21461986 CCAAAGGAAAACCTCAATTCAAA 0: 1
1: 0
2: 3
3: 27
4: 388
Right 1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG 0: 1
1: 0
2: 3
3: 29
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164036688 Original CRISPR TTGTGCCTGTGGAAGATAAA AGG Intronic
901567238 1:10128070-10128092 TTCTCCCTGTGGCAGATAAAAGG + Intronic
901814580 1:11787014-11787036 GTGTGCCTGTGGCAGAAAAGAGG - Exonic
901973430 1:12925999-12926021 TTTTCCCAGTGGAAGGTAAAGGG + Intronic
902011749 1:13275768-13275790 TTTTCCCAGTGGAAGGTAAAGGG - Intergenic
902534945 1:17114172-17114194 ATGGGCCTGTGGAAGGTCAAGGG - Intronic
903127743 1:21259187-21259209 TTGTGCCTCTGGGATAAAAAAGG + Intronic
903957472 1:27035267-27035289 TTGTGCTTGTAGAACAGAAAAGG - Intergenic
904839078 1:33359445-33359467 ATGTGCCTGTGGGAGAGGAATGG + Intronic
905727704 1:40268203-40268225 TAGTGCCTGTGTAATAAAAAAGG + Intronic
907475420 1:54702073-54702095 TCGTGCCTGGGGAAGACCAAAGG - Exonic
907594774 1:55709407-55709429 TTGTCCCTGGGAAAGATAAAAGG - Intergenic
910403023 1:86855888-86855910 CTGTGCCTGTGCAGGGTAAAAGG + Intergenic
910441852 1:87261191-87261213 TTGTGCCTGTTAAAGAAAAAGGG - Intergenic
910515327 1:88054152-88054174 CTCTGCCTGTGGAAAAGAAAGGG - Intergenic
910526228 1:88181736-88181758 TTGTGCATGAGGAAAAGAAAGGG - Intergenic
910575998 1:88764603-88764625 ATGGGCCAGAGGAAGATAAACGG - Intronic
910781958 1:90948311-90948333 TTGATCCTGTGGAATATACATGG - Intronic
910795429 1:91092779-91092801 TTTTGCCTGTGCAAGACTAATGG + Intergenic
911336388 1:96585431-96585453 TTGTAGCTTTGGTAGATAAATGG - Intergenic
913658554 1:120985092-120985114 TTGTACCTTTGGATAATAAAAGG - Intergenic
914009922 1:143768212-143768234 TTGTACCTTTGGATAATAAAAGG - Intergenic
914523168 1:148436336-148436358 TTGTACCTTTGGACAATAAAAGG - Intergenic
914648541 1:149676873-149676895 TTGTACCTTTGGATAATAAAAGG - Intergenic
917071247 1:171153220-171153242 TTGTGCCTTTCGAAGGAAAAAGG - Intronic
917903193 1:179564169-179564191 TATTGCCTGTGAAAGATTAACGG - Intronic
918372606 1:183876189-183876211 TTGTGACTCTGGGAAATAAAGGG + Intronic
918536535 1:185581278-185581300 ATGCACCTGTGGAAGATCAAAGG + Intergenic
918575129 1:186049084-186049106 TGCTGGCTGTGGAAGACAAAGGG - Intronic
920878030 1:209855405-209855427 TTATTCCTATGGTAGATAAAGGG + Exonic
922854191 1:228760197-228760219 TGATGTCTGGGGAAGATAAAGGG + Intergenic
923607634 1:235459099-235459121 TTGTAATTGTGGAAGAAAAATGG + Intronic
924778618 1:247128274-247128296 GTGTGCCTAGGGAAGACAAAAGG - Intronic
924783036 1:247170145-247170167 GTGTGCCTAGGGAAGACAAAAGG + Intronic
1065031941 10:21595352-21595374 TTGTACCTCTGGAATATACAGGG - Exonic
1065552851 10:26886943-26886965 ATCTGCTTGTGGAAAATAAAAGG - Intergenic
1065629981 10:27669737-27669759 TTGTGCTTGTGTAAGATGAGTGG - Intergenic
1066171737 10:32856047-32856069 TTTTGTCTGTGTAAGATAAAGGG - Intronic
1066975633 10:42365748-42365770 CTGTGCCTAGGGAAGATAAAAGG + Intergenic
1067751829 10:48976827-48976849 TTGTCCCTGTGGAATGTCAATGG + Exonic
1068081464 10:52323029-52323051 CTCTGCCTGTGCAATATAAATGG + Intergenic
1069002354 10:63280203-63280225 TTTTGCCTGGGGAAGAGAAGAGG + Intronic
1069149610 10:64942453-64942475 TTGTGGACTTGGAAGATAAATGG - Intergenic
1070280830 10:75047089-75047111 TTGTGCCTGAGGCAGAGAAAGGG + Intronic
1071796082 10:89007788-89007810 TTCTGCATTTGGAAGAAAAATGG - Exonic
1072230380 10:93409397-93409419 TTGTGCCTGCAGAAGAAAGATGG + Intronic
1072445897 10:95498236-95498258 TTCTTCCTCTGTAAGATAAAAGG + Intronic
1074543958 10:114388088-114388110 TTTTTCCTGTGGAAAATAGATGG + Intronic
1074867079 10:117550953-117550975 TTGTACTTGTTGAAGAGAAAGGG - Intergenic
1074957193 10:118403507-118403529 TTGTGCCTCCAGATGATAAAAGG - Intergenic
1075334665 10:121599784-121599806 TTTTGCCTGAGGCAGTTAAATGG - Intergenic
1078799235 11:14625799-14625821 AAGTGCCTATGAAAGATAAATGG - Intronic
1079684916 11:23347120-23347142 TTGTCCATTTGGAAAATAAAAGG + Intergenic
1080907461 11:36561026-36561048 TTGTGCCTAAGGAAGGTACATGG - Intronic
1081259455 11:40941546-40941568 TTGGGCATGGGGAAGCTAAATGG + Intronic
1081645775 11:44789343-44789365 TGGAGCCTTTGGAAGAAAAATGG + Intronic
1085948669 11:81303490-81303512 TTGTACATATGGAAGATGAAAGG + Intergenic
1087315683 11:96599817-96599839 ATGTTCCTGTGAAAGATAAGAGG + Intergenic
1087522542 11:99259685-99259707 ATGTGCCTGTGGAAATTGAAAGG + Intronic
1087774020 11:102241383-102241405 TTGTGGCAGTGGGAGAGAAAAGG + Intergenic
1088768531 11:113009751-113009773 TTGGGATTGTAGAAGATAAAGGG + Intronic
1091639141 12:2221298-2221320 TTCTGCCTGTGGATTAGAAAAGG + Intronic
1093993010 12:25610926-25610948 TTGTGACTGTTGAAGACAAGTGG - Intronic
1095709524 12:45273728-45273750 CTGTGCCTGTGAAATAGAAATGG - Intronic
1095743417 12:45631737-45631759 TTGTGCCCGTGGTAGAAAGAGGG + Intergenic
1096209612 12:49754566-49754588 TTGTTCCTGAGGGAAATAAAAGG - Intronic
1096907936 12:54952933-54952955 TTGTGTTTGGGGAAGAAAAATGG - Intronic
1097970959 12:65632630-65632652 TTGTGGTTGTGGTAGATTAAAGG - Intergenic
1098162419 12:67658169-67658191 TCTTGCCTGGGGAAGATGAAGGG + Exonic
1098833338 12:75390570-75390592 CTGTCCCTGAGGAAAATAAAAGG + Intronic
1099646016 12:85357783-85357805 TGGTGTCTGAGGAAGGTAAAGGG - Intergenic
1102412633 12:112733429-112733451 TAATGCCTGTGAAAGATAAAGGG + Intronic
1103373992 12:120440934-120440956 TTGTGCCTGATGTGGATAAAGGG + Intronic
1104045446 12:125159662-125159684 TGATTCCTGTGAAAGATAAAAGG - Intergenic
1108109876 13:47057948-47057970 TTATGCCCTGGGAAGATAAATGG + Intergenic
1108517039 13:51213216-51213238 CTTTGCCTCTGGAGGATAAAGGG - Intergenic
1110130618 13:72004543-72004565 TATTGCCTGTGGAAAATAATTGG + Intergenic
1110397641 13:75049973-75049995 ATGTGCCAGTGGAAGGAAAAGGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110746882 13:79064452-79064474 ATTTGCCTGTGAGAGATAAATGG - Intergenic
1111178622 13:84632819-84632841 TTGTTCCTGTGGGAAATACAGGG - Intergenic
1112283969 13:98087651-98087673 GGATGCCTGTGAAAGATAAAGGG - Intergenic
1114245113 14:20905569-20905591 CTCTGCCTGTGGAAGAGTAAGGG + Intergenic
1114598235 14:23932696-23932718 TTGTGCAGAAGGAAGATAAAAGG - Intergenic
1114923933 14:27369074-27369096 TCTTGCATGTGGAAGACAAATGG + Intergenic
1116075666 14:40107386-40107408 CTGTGACTTTAGAAGATAAATGG + Intergenic
1118401504 14:65383864-65383886 TTGGGCCTAGGGAAGATAAGAGG - Intergenic
1118543602 14:66858913-66858935 CTCTGCCTGTGGAAAATAGAGGG + Intronic
1118707706 14:68495314-68495336 TTGCGCCAGTGGAAGACAAAGGG - Intronic
1120159128 14:81127368-81127390 TGCTGCTTGTGGGAGATAAAAGG - Intronic
1120722011 14:87899915-87899937 ATGTGCCTGGAGATGATAAATGG - Intronic
1120884057 14:89437874-89437896 TTATGACTGTTGCAGATAAAGGG - Intronic
1123163963 14:106308048-106308070 TGGAGACTGAGGAAGATAAATGG + Intergenic
1125273529 15:37966947-37966969 CAGTGCCTATGGAAGAGAAAAGG + Intronic
1127223140 15:56901359-56901381 TGGTACCTTTGGAAGATACAAGG + Intronic
1128324036 15:66711985-66712007 ATGGGCCTGTCGAAGATGAATGG + Intronic
1128411863 15:67407477-67407499 CTGTGCCTGAGGAAGATGACAGG + Intronic
1130950303 15:88581329-88581351 TTCTGCCTGTGGAATATTCATGG - Intergenic
1131777310 15:95816232-95816254 TAATGCCTGTGAAAGACAAAAGG + Intergenic
1132408638 15:101560582-101560604 TTGTGCTTGTAGAAGAAAGAGGG - Intergenic
1133941049 16:10309322-10309344 TTGTGTCTGTAGTAGATACAGGG + Intergenic
1135127979 16:19827330-19827352 TTGTCCCTGTGGGAGAGAAATGG - Intronic
1138946313 16:61854531-61854553 TTATGACTGTGAAAAATAAAAGG - Intronic
1140693017 16:77502611-77502633 TTCTGCATTTGGAAGCTAAAAGG + Intergenic
1141040801 16:80670879-80670901 TTGCGCACGAGGAAGATAAAAGG + Intronic
1142851216 17:2705706-2705728 TTGAGCCTGGGCAAGATAGAAGG - Intronic
1142943189 17:3400533-3400555 TTGTGCCCGTGGAAAATATTAGG + Intergenic
1144275422 17:13663635-13663657 ATGTGACTTAGGAAGATAAAGGG + Intergenic
1150830673 17:68516411-68516433 TTGTGCATGTGGAAGTTATGAGG + Intronic
1156822592 18:41390782-41390804 TTTTGCCTCTGGAAAAAAAAAGG - Intergenic
1159687693 18:71443862-71443884 TTGTGGTTTTTGAAGATAAAAGG - Intergenic
1160888676 19:1365395-1365417 TTGTGTCTTAGGAGGATAAAGGG - Intronic
1161248750 19:3269489-3269511 TTGTGCCTTTGGAAGAGTAGAGG - Intronic
1162668534 19:12235922-12235944 CTGTGCCTAGGGAAGATAAAAGG + Intronic
1162700683 19:12512659-12512681 CTGTGCCTAGGGAAGATGAAAGG + Intronic
1163193309 19:15696144-15696166 TAATGCCTGTGGGAGAGAAAGGG - Exonic
1163983649 19:20924829-20924851 CTGTGCCTAGGGAAGATAAAAGG - Intronic
1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG + Intronic
1164042699 19:21507503-21507525 CTATGCCTAGGGAAGATAAAAGG - Intronic
1164054851 19:21614066-21614088 GTGTGCCTAGGGAAGATAAAAGG + Intergenic
1164055394 19:21617887-21617909 TTGTGCCTAGGGAAGATAAAAGG - Intergenic
1164529353 19:29036452-29036474 TAATGCCTGTGAAAGATAGAGGG + Intergenic
1164970841 19:32531270-32531292 TTGTGACTGATGAAGATAACAGG - Intergenic
1167502038 19:49854001-49854023 TTGTGCCTGTGGAGGCTGCAAGG + Intronic
1168259440 19:55185363-55185385 AGGTGGATGTGGAAGATAAAGGG - Intronic
925075178 2:1010378-1010400 TTGTGGCTGTTGTAAATAAAGGG + Intronic
928167934 2:28984269-28984291 TTTTGCCTGGGAAATATAAATGG - Intronic
929022747 2:37569652-37569674 TTCTGCCTGTGAAAGCCAAAAGG + Intergenic
929024382 2:37585603-37585625 TGATGCCTGTGAAGGATAAAGGG + Intergenic
929326556 2:40618768-40618790 TTGTGCGTGTTGAAGGTAATAGG - Intergenic
929993849 2:46812578-46812600 TTGTGACTCTGGCAGAGAAATGG - Intergenic
932211506 2:69935367-69935389 TTGTGCCTGGAGAAGTTGAAGGG + Exonic
935091903 2:99902993-99903015 TTATGCCTCTGGAGGAGAAATGG - Intronic
935148060 2:100409694-100409716 TTGTTCCTGTGGATGAAAAATGG - Intronic
935222885 2:101029769-101029791 TTGTGCCCCTGGAAAAGAAAGGG + Exonic
935724521 2:106011371-106011393 AGCTGCCTGTGGAGGATAAAGGG + Intergenic
938627907 2:133131740-133131762 ATGTGGTTGTGGAAGATAAATGG + Intronic
938917857 2:135961635-135961657 TTTTGTCTGTGGAAGCCAAATGG - Intronic
939608289 2:144279126-144279148 TTGGCCCTGTAGAAGATAAGAGG - Intronic
939875204 2:147569922-147569944 TATTGCCTGTGGAAGTCAAAAGG - Intergenic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
941419268 2:165262010-165262032 TTCTGCCTGGGAAAGGTAAAAGG + Intronic
943268031 2:185762570-185762592 TTGTGCCTGGGTGAAATAAAAGG - Intronic
944663585 2:201940778-201940800 TAATGCCTGTGAAAGATGAAAGG - Intergenic
945371818 2:209027939-209027961 TTGTTCCTATGGAAAATACAAGG + Intergenic
946929674 2:224659390-224659412 TGGGGCCTTTGGAAGATAATAGG + Intergenic
948776380 2:240290945-240290967 TTGTGCCCGTGGAAGATTCCGGG - Intergenic
1169163233 20:3400915-3400937 TGGTGCCTGTAGAAGTAAAAAGG - Intronic
1170146813 20:13184509-13184531 TTGTGATTGTGAAAGATTAAAGG - Intergenic
1172478984 20:35259953-35259975 TTCTTCCTCTGGAAGATAGAAGG - Intronic
1174025607 20:47571675-47571697 TTCTGCCTGTGCATTATAAATGG - Intronic
1174107919 20:48176134-48176156 TTATGCCTGTGTAAGGTTAATGG + Intergenic
1176843893 21:13861818-13861840 TGGTGGCGGTGGAAGGTAAAAGG - Intergenic
1182109028 22:27709927-27709949 TTGTGGTTGTGGAAGAGCAAAGG - Intergenic
1183254290 22:36752149-36752171 TTGTACATGTGGAGGAGAAAGGG + Intergenic
1185215371 22:49596712-49596734 TTCTGCCTGTGTAAGATACAAGG - Intronic
952106286 3:30073445-30073467 TTTTGCCTTTTGAAGATCAAAGG - Intergenic
952817503 3:37458362-37458384 TATTGCCTGTGAAAGACAAATGG + Intronic
953613762 3:44471111-44471133 CTGTGTCTGTGGAACATTAATGG - Intronic
954988453 3:54816845-54816867 TTGTGCCTGAGGGAGCTGAAGGG - Exonic
958614558 3:96474960-96474982 GCTTGCCTGTGGTAGATAAATGG + Intergenic
959027778 3:101260655-101260677 ATGTGTATGTGGAAGATATAAGG - Intronic
960762626 3:121090549-121090571 TTGCTCCTGTGGAACAGAAAGGG + Intronic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964535068 3:157712118-157712140 TTCTGCCTGTGCACTATAAATGG + Intergenic
964959235 3:162403721-162403743 TTTTGCCTTTGGAAGAGGAAGGG + Intergenic
965028224 3:163329257-163329279 TTGTGGCTGTGGGAGAAACAAGG + Intergenic
965153329 3:165011452-165011474 TTGTGGCTGGGAAAGATAAATGG + Intronic
966178439 3:177165269-177165291 TTGTGCCTGAGTAATATAAATGG - Intronic
966205792 3:177404948-177404970 TTGTACTTGTTGAAAATAAAGGG - Intergenic
966454588 3:180100927-180100949 TTGACACTGTGGAAGATGAATGG + Intergenic
966824619 3:183953242-183953264 TTGTGCAGCTGGAAGAGAAAGGG - Exonic
970012977 4:11480930-11480952 TTTTGCCTGTGAAAGACAAAGGG + Intergenic
970915958 4:21335207-21335229 TTGTGACTTTGGAAGATAACTGG + Intronic
972319372 4:37958912-37958934 ATGTGCCAGTGGAAGACAATGGG - Intronic
973841482 4:54865422-54865444 TTGAGTGTGTGGAAGATAAGTGG - Intergenic
974247709 4:59342168-59342190 TTGTCACTGCGGAAGAAAAAAGG + Intergenic
974397101 4:61351649-61351671 CTGTGCCTGTGCTATATAAATGG + Intronic
979442205 4:120764077-120764099 TTTTTCCTTTGGAAAATAAAAGG - Intronic
979560506 4:122096462-122096484 ATCAGCCTGTGAAAGATAAAAGG + Intergenic
979750590 4:124274422-124274444 TTGATCCTTTGGAAGAGAAAGGG + Intergenic
980748589 4:137057293-137057315 TTTGGCCTGTAGAAGGTAAATGG - Intergenic
981433934 4:144697551-144697573 TGCTGCCTGAGCAAGATAAAAGG + Intronic
982388246 4:154836233-154836255 TTCTGCCTGTGAATGATCAAAGG + Intergenic
982388697 4:154839897-154839919 TTCTGCCTGTGAATGATCAAAGG + Intergenic
982533921 4:156584714-156584736 TTGTCCTTGGGGAAGATACATGG + Intergenic
983546319 4:168968198-168968220 TTGTTCCTGTAGAAAATATAAGG - Intronic
984040714 4:174730076-174730098 TTGTCACTTTGGAAGATACATGG - Intronic
984121645 4:175752483-175752505 TTTTGCTTGAGGAAGATGAAGGG - Intronic
984829163 4:183955189-183955211 TTGTACATGCGGAAGATAAAGGG - Intronic
986921674 5:12691454-12691476 TATTGCCTAAGGAAGATAAAAGG + Intergenic
987039551 5:14049180-14049202 AACTGCCTGTGAAAGATAAAAGG + Intergenic
987739826 5:21893049-21893071 TTGTTACTATAGAAGATAAAGGG - Intronic
988270858 5:29014636-29014658 TTATGACTGTGGAATACAAAAGG - Intergenic
988954583 5:36302148-36302170 TTGTGCATGTGAAATCTAAAAGG + Intergenic
992228975 5:74644618-74644640 TTTTGTCTGGGGAAGACAAAGGG + Intronic
993893225 5:93500359-93500381 TTGTGCCTGTGCTCTATAAATGG + Intergenic
996373589 5:122778889-122778911 TTGTGACTGTGAAACAAAAAAGG + Intronic
996784937 5:127228536-127228558 TTATGCCTTGGAAAGATAAATGG - Intergenic
999245188 5:150150445-150150467 TGGTACCTCTGGCAGATAAAAGG + Intronic
1000110080 5:158099851-158099873 ATGAGGCGGTGGAAGATAAAGGG + Intergenic
1001956958 5:175854214-175854236 TTCTCACTGTGGAAGATAAAAGG - Intronic
1003115607 6:3281844-3281866 TTGTGCCTGCAGAGGATGAAAGG - Intronic
1003650687 6:7957254-7957276 TCTTGCCTTTGCAAGATAAATGG - Intronic
1003861479 6:10326232-10326254 TTGTGACTGGGGAAGATTAAAGG - Intergenic
1004000708 6:11594461-11594483 TGGTGCCTGGGGAAGGTGAAAGG - Intergenic
1004156220 6:13170727-13170749 TTCTGTCTGTGGAAGATACAGGG + Intronic
1004944742 6:20598744-20598766 TTCTGCCTCTGGAAGATGAAAGG + Intronic
1005863216 6:29917205-29917227 TTGTGCCTGTGGAAGATCACGGG - Intergenic
1007183568 6:39948628-39948650 TTCTGCCTGTGGCAGATACTAGG + Intergenic
1007870138 6:45026010-45026032 TTGTCCTTTTTGAAGATAAATGG + Intronic
1009804257 6:68581985-68582007 TTGTGCTTGTGTATTATAAAAGG + Intergenic
1010525863 6:76899738-76899760 TGGTGCCTGTGTAGGATAGAGGG + Intergenic
1011357811 6:86490449-86490471 TAATGCCTGTGAAAGGTAAAAGG - Intergenic
1013522603 6:110946817-110946839 CAGTGACTGAGGAAGATAAAGGG - Intergenic
1014063499 6:117100317-117100339 GTGTTCCTTTGGAGGATAAAAGG + Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1014724579 6:124960074-124960096 TTAAGCTTGTGGCAGATAAATGG + Intergenic
1014730572 6:125026764-125026786 TTGACCCTGTGGAAGACAAGTGG + Intronic
1017652051 6:156592933-156592955 TTGTGCATGTGGGGGATACATGG + Intergenic
1017978927 6:159381612-159381634 TTGTGCCTCTGGAATAAAACAGG + Intergenic
1018372116 6:163177925-163177947 TTGTGCCTGTGGTGAACAAATGG - Intronic
1018719557 6:166562641-166562663 TTGAGCCTGAGGCAGAGAAAGGG - Intronic
1019152194 6:170015053-170015075 TTGTATCTGTGGAGGATGAAAGG + Intergenic
1020806488 7:12795925-12795947 TAGTGCCTGAGGAAGAAACAAGG + Intergenic
1022474062 7:30699074-30699096 TAGTGCCTGTGGAAGCTAAGAGG - Intronic
1022493568 7:30838859-30838881 TCTTGCCTGTGGAAGATCAGAGG + Intronic
1025708263 7:63886555-63886577 TTGCCCCTGTGGAGGTTAAATGG + Intergenic
1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG + Intronic
1025788670 7:64667449-64667471 CTGCGCCTAGGGAAGATAAAAGG - Intronic
1026285896 7:68962555-68962577 TTGAGCCTTTGGGAGCTAAAAGG + Intergenic
1026350481 7:69511140-69511162 TTGTGCCTCTGAAACATACAGGG - Intergenic
1026784481 7:73293491-73293513 TTTTAGCTGTGGAAGAGAAATGG + Intergenic
1027109590 7:75426437-75426459 TTTTAGCTGTGGAAGAGAAATGG - Exonic
1029489714 7:100864027-100864049 TTTTTCCTGTGGAAGATATCAGG + Intronic
1029897164 7:103995273-103995295 TTGTACGTTTGGAAGATCAAGGG + Intergenic
1031577665 7:123435670-123435692 TTATGCTTGTGAAACATAAACGG - Intergenic
1031869830 7:127079683-127079705 TAGTCCCTGAGGAAGAAAAAAGG - Intronic
1032695899 7:134336017-134336039 TGGTACATGTTGAAGATAAAAGG + Intergenic
1036102635 8:5803394-5803416 TTGTGCACGTGGATGATGAAAGG + Intergenic
1036196621 8:6722425-6722447 ATTTGCATGTGGAAGACAAATGG + Intronic
1036289656 8:7476288-7476310 AAATGCCTGTGAAAGATAAAGGG + Intergenic
1036331820 8:7835244-7835266 AAATGCCTGTGAAAGATAAAGGG - Intergenic
1036436639 8:8740709-8740731 TTGTGTATGGGGAAGATAAGGGG - Intergenic
1037145852 8:15571963-15571985 TTGTGCCTGTGCTCTATAAATGG - Intronic
1038255528 8:25947693-25947715 TTGTGCATGTGCAAGAAAGAAGG - Intronic
1038279513 8:26151262-26151284 TTGTACCAATGGAAAATAAAGGG - Intergenic
1039643180 8:39246611-39246633 TTGTGCCTCTGTAAGATGAGTGG - Intronic
1039858367 8:41435563-41435585 TTGTGCTGTTGGAAGAAAAAAGG - Intergenic
1040613386 8:49009447-49009469 TGGTGTCTGTGGAAGACACATGG - Intergenic
1041352574 8:56963042-56963064 TTTTCCCTGTGGAAGATGCATGG - Exonic
1041995183 8:64046835-64046857 CTGTGCTTGTGGAATTTAAAAGG + Intergenic
1042194956 8:66223900-66223922 AAGTGCCTGTGAAGGATAAAGGG + Intergenic
1042515775 8:69657377-69657399 TTGTGCCTGTGCACGATTGAAGG - Intronic
1042714523 8:71758204-71758226 TTGCGCCTCAAGAAGATAAAGGG + Intergenic
1045354335 8:101372004-101372026 CAGTGCCTGTGGAAAATAAGGGG + Intergenic
1045933408 8:107653282-107653304 GTGTTCCTTTGGAAGATAAGAGG + Intergenic
1046502647 8:115098170-115098192 TGGTGTCTGTGGAAAATAAATGG + Intergenic
1047271965 8:123369086-123369108 TTGGTCCTGCGGAAGATAATCGG + Exonic
1047322387 8:123799603-123799625 TTGTACCTTTGGACAATAAAAGG - Exonic
1050101645 9:2126146-2126168 ATGTGCATGTTGTAGATAAAAGG - Intronic
1051184473 9:14443708-14443730 TTGTACATGTGGAAAATTAAAGG - Intergenic
1051328270 9:15997071-15997093 GAGTGCCTGTGAAAGATAAAGGG + Intronic
1058321528 9:103636951-103636973 TTGTGCCTCAGGAAGAGAAAAGG - Intergenic
1059388412 9:113983483-113983505 TTGTGCCCGTGGGTGATAGAGGG + Intronic
1059558371 9:115306020-115306042 TTTTACCTGTTGAAGATAAGGGG - Intronic
1059612078 9:115909289-115909311 CTGTATATGTGGAAGATAAAAGG + Intergenic
1060492041 9:124092214-124092236 TGGAGCCTTTGGAAGATAATAGG + Intergenic
1186011671 X:5141539-5141561 TTGGGATTGTGGAACATAAAAGG - Intergenic
1186992746 X:15087080-15087102 TTGTGACACTGGAAAATAAAGGG + Intergenic
1187448782 X:19379054-19379076 TTCTCCCTGTTGAAAATAAAGGG + Intronic
1189645281 X:43121695-43121717 TTGTGCCTGTAGGAGGTACAAGG - Intergenic
1189725732 X:43966597-43966619 TTCTCCCTGTGGAAAAGAAAAGG + Intronic
1194091060 X:89582266-89582288 TTTTGCTAGTGAAAGATAAAAGG - Intergenic
1196780727 X:119381736-119381758 TAATACCTGTGAAAGATAAAAGG - Intergenic
1197164061 X:123356935-123356957 TAATACCTGTGAAAGATAAAAGG + Intronic
1198573124 X:137979570-137979592 CTGTGTCTGTTAAAGATAAAAGG + Intergenic
1199433930 X:147791579-147791601 TTGAGCCTGTGGAAGGTAATAGG + Intergenic
1200443703 Y:3238328-3238350 TTTTGCTAGTGAAAGATAAAAGG - Intergenic
1202357817 Y:24070719-24070741 AGGTGCTTGAGGAAGATAAAAGG - Intergenic
1202512961 Y:25599394-25599416 AGGTGCTTGAGGAAGATAAAAGG + Intergenic