ID: 1164044060

View in Genome Browser
Species Human (GRCh38)
Location 19:21519279-21519301
Sequence TCCCTATGTTGAGGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 22, 2: 38, 3: 38, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164044060 Original CRISPR TCCCTATGTTGAGGGAATGC TGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
909146785 1:71944418-71944440 TCCCTAAATTGAGGGAATAAAGG + Intronic
909646421 1:77922024-77922046 TCCCAAAGTTGGGGGAATACAGG + Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911762275 1:101630130-101630152 TCCCTGAGTTCAGGGAATACAGG + Intergenic
911954002 1:104213002-104213024 ACCCTAAGTTTAGGGAATCCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918453285 1:184681569-184681591 TTCCTGTGTTGAGGGAAGTCAGG - Intergenic
919058961 1:192606808-192606830 TCCCTGTGATGAGACAATGCTGG + Intergenic
921554196 1:216577211-216577233 TCCCTATGTTCAGCAAATGCAGG - Intronic
921935852 1:220796378-220796400 TCCCTACCTGGAAGGAATGCAGG - Intronic
922331953 1:224585295-224585317 TACGTATGTTGAGTGATTGCGGG - Intronic
1066455012 10:35565183-35565205 TCTACATGTTGATGGAATGCTGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1071576052 10:86727278-86727300 TCCCCAAGTTGTGGGAATACAGG + Intronic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090476428 11:127025791-127025813 TCCTAATGTTGAGGGTATGGAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096840341 12:54376003-54376025 TATCTGTGTTGGGGGAATGCTGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098051230 12:66455493-66455515 TCCCCATGTTCAGGGAACTCAGG + Exonic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109156248 13:58913640-58913662 TCCCTTTGTTCAGAGAAAGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116581392 14:46646685-46646707 TCCATATTTTGAGAGATTGCAGG + Intergenic
1116904673 14:50393057-50393079 ACCCTATATTGAGGGAACACAGG - Intronic
1117334733 14:54747383-54747405 ACTCTAGGTTTAGGGAATGCGGG - Intronic
1119234101 14:73005266-73005288 TCCCTTTGATGAGGGAAGGAAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1142534457 17:604856-604878 TCCCTTTGTTGAGTGGATGAGGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1146929302 17:36766432-36766454 CCCCTACGCTGAGGGAATCCAGG + Intergenic
1147540724 17:41356540-41356562 TCCCTATGTAGAGGGAACTGGGG - Intergenic
1147992835 17:44345549-44345571 TCCCTGCTTTGGGGGAATGCTGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1155824836 18:30427914-30427936 TCTGTATGTTAAGGAAATGCAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163385996 19:17000983-17001005 TCCTGATGCAGAGGGAATGCTGG + Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164573834 19:29393698-29393720 CCCCTCTGTTCAGGGAATGTAGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
929073870 2:38061218-38061240 TCCCCATGTGAAGGAAATGCAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934032518 2:88061113-88061135 TCTTTAGGGTGAGGGAATGCTGG + Intergenic
935220725 2:101010138-101010160 TCCCAATGTTTAGGAAATGTAGG - Intronic
935794719 2:106630051-106630073 AGCCTATGTTAAGGGAATCCAGG - Intergenic
937944152 2:127316112-127316134 TCCCAATGTCGTGGGATTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
939021017 2:136958602-136958624 TCACTATTTTGAGGGAATTGGGG + Intronic
941622501 2:167793890-167793912 TCCCTATGCGGAGGGCATGAAGG - Intergenic
942593012 2:177566214-177566236 ACCCTATGGTGGAGGAATGCTGG - Intergenic
945031008 2:205663590-205663612 TCCTTATGGTGAGGGAAGGATGG + Intergenic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168941949 20:1720295-1720317 TACCTATGTTCAAGGGATGCAGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176277515 20:64280758-64280780 TCACCCTGGTGAGGGAATGCTGG + Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177104833 21:16942969-16942991 TCCCAATAGTGTGGGAATGCTGG + Intergenic
1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181477233 22:23176235-23176257 TCCCTCTGTTGGGGAAAAGCTGG + Intergenic
1181917642 22:26293196-26293218 TCACTATGTTCAGGGCATGTGGG + Intronic
1183540854 22:38428522-38428544 TCCCTATGCTCAGGGCAAGCAGG - Intronic
1184225417 22:43126886-43126908 TCCCTACTTGGAGGGGATGCGGG - Intronic
950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG + Intergenic
952041165 3:29263657-29263679 TCCCCAGGGTGAGAGAATGCTGG + Intergenic
957239067 3:77635007-77635029 TCCCTTCGATGAGGCAATGCTGG - Exonic
958487660 3:94732327-94732349 TCCATTTGATGATGGAATGCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
963599856 3:147369469-147369491 TCCCTACGTTCAGCGAATACAGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966168176 3:177045572-177045594 TCCCAATGTTGTTGGAATGTTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
977210163 4:94208937-94208959 TCAATATTTTGAGGGAATACTGG - Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
995977521 5:118058328-118058350 TCACTATGTTGAGGCCAGGCTGG + Intergenic
996339035 5:122415822-122415844 TCCCTTTCTTGAGGAAATGTAGG - Intronic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
1001147740 5:169199636-169199658 TCCCTATATTTAGGAAATACTGG + Intronic
1001226727 5:169951040-169951062 TCACTGTGGTGTGGGAATGCAGG - Intronic
1001505788 5:172279034-172279056 TCCCAATGTGGTGCGAATGCAGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003758626 6:9150230-9150252 TCCATTTGATGATGGAATGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1013833118 6:114298620-114298642 GTCCTATGTTGCGGGAAGGCAGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1021640412 7:22730746-22730768 TCCCAAAGTTTAGGGAATACAGG - Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1032420450 7:131774991-131775013 TCTCTTTGCTGAGGAAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032929485 7:136649768-136649790 TCTCTATGTGGATGGAATCCTGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034609337 7:152351579-152351601 TCCCTTTGTTGTGGGAAGTCAGG + Intronic
1037646538 8:20797368-20797390 TCCATATGCTGAGGCCATGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043786489 8:84407295-84407317 TCCCCATGATGAGGAAAGGCAGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1053186349 9:36019858-36019880 TCAATTTGTGGAGGGAATGCAGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1058453391 9:105117279-105117301 TCTCCTTGTTGAGTGAATGCAGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062570342 9:137182090-137182112 TCCCTATGTGCTGGGATTGCAGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195371598 X:104180237-104180259 TCCCAATGTGGTGGGAATACAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201667838 Y:16478969-16478991 TTCCTGTGTTGAGGGAATTAAGG - Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic