ID: 1164045133

View in Genome Browser
Species Human (GRCh38)
Location 19:21531322-21531344
Sequence ATAGGGCATCTCAGCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164045123_1164045133 22 Left 1164045123 19:21531277-21531299 CCGCAGCCTTGTGACCAAGCTAC 0: 1
1: 0
2: 1
3: 8
4: 155
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045127_1164045133 -4 Left 1164045127 19:21531303-21531325 CCCTCTCTATTACAAATCCATAG 0: 1
1: 0
2: 5
3: 252
4: 12551
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045122_1164045133 23 Left 1164045122 19:21531276-21531298 CCCGCAGCCTTGTGACCAAGCTA 0: 14
1: 11
2: 10
3: 38
4: 279
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045128_1164045133 -5 Left 1164045128 19:21531304-21531326 CCTCTCTATTACAAATCCATAGG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045126_1164045133 -3 Left 1164045126 19:21531302-21531324 CCCCTCTCTATTACAAATCCATA 0: 1
1: 0
2: 6
3: 392
4: 17901
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045124_1164045133 16 Left 1164045124 19:21531283-21531305 CCTTGTGACCAAGCTACAACCCC 0: 11
1: 10
2: 11
3: 21
4: 108
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045121_1164045133 24 Left 1164045121 19:21531275-21531297 CCCCGCAGCCTTGTGACCAAGCT 0: 1
1: 14
2: 8
3: 17
4: 88
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129
1164045125_1164045133 8 Left 1164045125 19:21531291-21531313 CCAAGCTACAACCCCTCTCTATT 0: 1
1: 0
2: 5
3: 22
4: 122
Right 1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG 0: 1
1: 0
2: 0
3: 27
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164045133 Original CRISPR ATAGGGCATCTCAGCACCCT GGG Intronic
900743818 1:4346597-4346619 AAAAGGCTCCTCAGCACCCTTGG - Intergenic
901791012 1:11653826-11653848 ACTGGGCATCTCACCACCCCGGG + Intronic
902933938 1:19750851-19750873 TCAGGGCATCTCAGCAACCTTGG - Intronic
908459356 1:64334247-64334269 ATAGGGCAGCTTAGCAGCCAAGG - Intergenic
908931051 1:69316162-69316184 AAAGGGCAGCACAGCACACTAGG - Intergenic
912909563 1:113744386-113744408 ATAGAAAATTTCAGCACCCTAGG - Intronic
913238385 1:116804989-116805011 ATAGGTCATCTCCTCACCCCAGG + Intergenic
914384704 1:147157227-147157249 ATAAGGCTTCTCAGAACCATGGG + Exonic
917314999 1:173715151-173715173 ATGGGGCAGCTCAGCAACTTGGG - Intronic
918988588 1:191666427-191666449 CTTTGGCATCTCAGCCCCCTTGG - Intergenic
922414711 1:225410547-225410569 ATAAGACATCTCAGCACCATGGG + Intronic
1064430243 10:15264523-15264545 ATCGGGCATCTCAGCACTTTGGG + Intronic
1066974203 10:42349872-42349894 ATAGGGCATCCCATTACCCTGGG + Intergenic
1067493275 10:46735352-46735374 ATAGGGCATCTCTACACTCTAGG - Intergenic
1067601386 10:47605052-47605074 ATAGGGCATCTCTACACTCTAGG + Intergenic
1069997834 10:72354038-72354060 CCAGGGCAACTCAGCAGCCTCGG + Intronic
1071652935 10:87412922-87412944 ATAGGGCATCTCTACACTCTAGG + Intergenic
1073404351 10:103284254-103284276 CTAGGGCATCCCAGCACTTTGGG - Intronic
1073514241 10:104062720-104062742 TTAGTGCCTCTCAGCACCCGAGG - Intronic
1075263186 10:120980146-120980168 ATAGGGCCCCTCAGCCCCCAAGG - Intergenic
1076798722 10:132811044-132811066 GAAGGGCAGCTCAGCAGCCTTGG + Intronic
1083183076 11:61000703-61000725 ATGGGACATCTCAGGAGCCTGGG + Intronic
1083572333 11:63767453-63767475 ATAGGTCATGTCCGCACTCTGGG + Intronic
1085133959 11:74067987-74068009 ACAGGGCCTCTCTGCACCCAGGG - Intronic
1085806247 11:79639309-79639331 AGAGGGCATCTCACCATTCTGGG + Intergenic
1086060909 11:82698993-82699015 AGAGGGCTTCTCATCACACTGGG + Intergenic
1088031299 11:105254120-105254142 AAAGGGAATCTCAGTACCATAGG + Intergenic
1088580670 11:111312645-111312667 ATGGGGTATCTCAGAGCCCTGGG + Intergenic
1090331409 11:125935359-125935381 ACAGGGCATCTCTCTACCCTTGG - Intergenic
1096349395 12:50883067-50883089 ATCTGTCATCTCAGCACTCTGGG + Intronic
1102446262 12:113005138-113005160 AGAGAGAAGCTCAGCACCCTGGG - Exonic
1105229819 13:18481653-18481675 ATAGGGCATCCCATTACCCTGGG + Intergenic
1106316491 13:28598977-28598999 AGAGGGCTTCTCAGAACCATAGG - Intergenic
1106668753 13:31882048-31882070 CTAGGGCATTTCAGCACACATGG - Intergenic
1107107313 13:36658710-36658732 CTAGGGCATCTCAGAACTCAAGG + Intergenic
1107170880 13:37341220-37341242 TCCGGGCATCTCAGCACTCTTGG + Intergenic
1108325527 13:49326956-49326978 ATAGGCCCTCTCAAGACCCTTGG - Intronic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1113896188 13:113766005-113766027 ATAGTGCATCCCAGGACCCCTGG + Intronic
1114014067 14:18408490-18408512 ATAGGGCATCCCATTACCCTGGG + Intergenic
1114957115 14:27836373-27836395 ATAGGTCAGATCAGCACCTTTGG - Intergenic
1116831558 14:49725118-49725140 ATAGAGGATTTCAGCACCCTGGG + Intronic
1121847228 14:97183537-97183559 ATTCTGCATCTCAGCATCCTGGG + Intergenic
1124102685 15:26710519-26710541 ATAGGCCATCCCAGCACTTTGGG - Intronic
1126127511 15:45309096-45309118 ATAGGGCATCACTGCAGCCCAGG - Intergenic
1126379305 15:48029612-48029634 ATATGGTATCACAGCACCCCAGG + Intergenic
1130864473 15:87920668-87920690 ATAGGGTTTCTCAGCACCTCTGG + Intronic
1130953397 15:88610162-88610184 ATAGGAGAGCTTAGCACCCTAGG - Intergenic
1131795644 15:96013495-96013517 ATATGGAATCCCAGCACTCTGGG + Intergenic
1132807354 16:1781302-1781324 CTAGGGCATCTCCACACCTTAGG + Intronic
1133861525 16:9599779-9599801 GAAGGGCATCTCAGCACCAAGGG - Intergenic
1136099616 16:27984225-27984247 CTTTGGCATCTCAGCTCCCTTGG + Intronic
1141678188 16:85528739-85528761 ATAAGACATCCCACCACCCTTGG - Intergenic
1142177987 16:88653725-88653747 ATGGGGCTTGGCAGCACCCTTGG - Intronic
1143350610 17:6285506-6285528 ATGGGGCATCTCATCCCCCAGGG + Intergenic
1145224409 17:21116134-21116156 ATAGGGCAGCTCAGCAAGCTTGG - Intergenic
1148002602 17:44398512-44398534 ATAGGGCATCACTACTCCCTGGG + Exonic
1150113169 17:62520122-62520144 ATGGGGCAGGTCAGCAGCCTGGG + Intronic
1154523583 18:15258187-15258209 ATAGGGCATCCCATTACCCTGGG - Intergenic
1157287074 18:46384261-46384283 CTTGGGCATCCCAGCCCCCTGGG - Intronic
1159855275 18:73579899-73579921 TTAGGGATTTTCAGCACCCTGGG + Intergenic
1160503852 18:79416635-79416657 ATGGGGCAACTCGACACCCTCGG - Intronic
1161580008 19:5075570-5075592 ACAGGGAATCTCAGCACTTTGGG - Intronic
1163722058 19:18903043-18903065 ATGGGGCATCTGGGCAGCCTGGG - Intronic
1163984932 19:20937383-20937405 AGAGGGCATCCCGTCACCCTGGG - Intronic
1164001224 19:21101292-21101314 AGAGGGCATCCCATCACCCTAGG - Intronic
1164007988 19:21169495-21169517 AGAGGGCATTCCATCACCCTAGG - Intronic
1164014697 19:21242973-21242995 AGAGGGCATCCCAGAACCCTGGG + Intronic
1164031268 19:21407982-21408004 AGAGGGCATCCCAAAACCCTGGG - Intronic
1164045133 19:21531322-21531344 ATAGGGCATCTCAGCACCCTGGG + Intronic
1164102930 19:22075062-22075084 AGAGGGAATCCCATCACCCTGGG - Intronic
1164134438 19:22400597-22400619 ATAGGACATCCCATCACCCTGGG + Intronic
1164141170 19:22465850-22465872 AGAGGGCATCCCATCACCCTGGG - Intronic
1164164374 19:22656176-22656198 ATAGGACATCCCATCACCCTGGG - Intronic
1164224448 19:23229723-23229745 ATAGGGCATCCCATTATCCTGGG + Intronic
1164279110 19:23752715-23752737 AGAGGGCATCTCATTACCCTGGG + Intronic
1164892937 19:31840301-31840323 ATCTGGCAACTCACCACCCTAGG + Intergenic
1166809554 19:45507348-45507370 AAAGGGCAACTCTGCACCCTCGG - Intronic
1167365974 19:49055174-49055196 TTGGGGCATCTCAGGTCCCTCGG - Intronic
1167677151 19:50894444-50894466 CTAGGTTATCTCAGAACCCTGGG - Intergenic
1168344699 19:55644493-55644515 AGAGGGCAGCTCAGCACCACAGG - Intronic
1168630317 19:57950891-57950913 ACAGGGCATCCCTGCACTCTTGG - Intergenic
927108970 2:19850833-19850855 AGAGGGCATCTCAGCATGGTGGG - Intergenic
928873499 2:36010249-36010271 AGAATGCATCCCAGCACCCTGGG + Intergenic
929356438 2:41030143-41030165 GAAGGGGATCTCAGTACCCTGGG - Intergenic
936399477 2:112154675-112154697 ATAGCCCCTCACAGCACCCTTGG + Intronic
940935040 2:159483457-159483479 ATAAGGCATCCCAGCACTTTGGG - Intronic
942279514 2:174345768-174345790 TTAGGGCTTTTGAGCACCCTTGG + Intergenic
945108813 2:206343522-206343544 CTTTGGCCTCTCAGCACCCTTGG + Intergenic
946321611 2:218958024-218958046 ACAGGGTATCTCTGCTCCCTAGG - Intergenic
946965586 2:225034015-225034037 TTATGACATCTCAGCAACCTGGG - Intronic
948519038 2:238524015-238524037 GCAGGGCATCACAGCACCCACGG + Intergenic
1172559546 20:35874824-35874846 ATAGTGAATCTCAGCACTCTGGG + Intronic
1172845453 20:37927594-37927616 ATAGGGTAACTCAGCAGCCCGGG - Intronic
1174036039 20:47668826-47668848 ATGGTGCTTCTCACCACCCTCGG + Intronic
1174324303 20:49767021-49767043 TTTGGGCATCTGAGCATCCTGGG - Intergenic
1175665149 20:60852371-60852393 ATGGTGCATCTCATCAGCCTGGG - Intergenic
1175802052 20:61806452-61806474 ACAGGGCACCTCCTCACCCTGGG - Intronic
1175846605 20:62063104-62063126 AAAGGGCGTCTCAGCAACCCCGG + Intronic
1176158742 20:63637593-63637615 ATATGGCATCCCTGTACCCTGGG - Intergenic
1176773809 21:13110012-13110034 ATAGGGCTTCCCATTACCCTGGG + Intergenic
1178677277 21:34641974-34641996 ACACAGCATCTCAGCACCCAGGG + Intergenic
1179596412 21:42445835-42445857 ATAGGGCAGCTCAACCCCCCTGG + Intronic
1180438566 22:15339296-15339318 ATAGGGCATCCCATTACCCTGGG + Intergenic
1180521419 22:16209724-16209746 ATAGGGCATCCCATTACCCTGGG + Intergenic
1181423525 22:22818300-22818322 ATTGGTCCTCACAGCACCCTGGG + Intronic
1182111233 22:27725206-27725228 ACCTGACATCTCAGCACCCTGGG + Intergenic
1182145586 22:27994933-27994955 AGAGGGCCTCCCAGCACCCTGGG + Intronic
949531873 3:4963912-4963934 ATAAGGCTTCTCAGAACCATGGG - Intergenic
950128036 3:10522724-10522746 ATAGAGCCTCACAGCAGCCTGGG + Intronic
964057390 3:152477885-152477907 ATAGGACTTCTCAGAACCCCTGG - Intergenic
967384938 3:188901944-188901966 ACAGGGCCTTTCAGCTCCCTGGG + Intergenic
968552166 4:1229350-1229372 ACAGAGCATCTCTGCACCCGTGG - Intronic
970125256 4:12802430-12802452 ATAAGGAAACTTAGCACCCTGGG + Intergenic
970276427 4:14405830-14405852 AGAGGGCAGCTCAGGACCCTTGG - Intergenic
970813832 4:20129040-20129062 ATAGGGCAACTCTTCACCTTAGG + Intergenic
975826513 4:78325534-78325556 ACAGCGCATGTCAGCACTCTAGG - Intronic
980574460 4:134666789-134666811 ATTGGGCATCTCTGCACTCTTGG - Intergenic
984741712 4:183170572-183170594 AAAGTGCATCTCAGCATCCCAGG - Intronic
987617895 5:20300566-20300588 ATGGGGAATCTCAACACCCGGGG - Intronic
989603389 5:43220934-43220956 AGAGGGCATCTCTGCACTCTCGG - Intronic
992673678 5:79084230-79084252 ATGGGGCACCACAGCTCCCTGGG + Intronic
995264228 5:110139220-110139242 CTAAGCCATCTCAGCTCCCTAGG - Intergenic
998232637 5:140371016-140371038 CTAGGGCATCTGGGCATCCTGGG + Intronic
999072593 5:148762205-148762227 AAAGTGAATCTCTGCACCCTTGG + Intergenic
1001130401 5:169059018-169059040 TCAGGGCTTCTCAGCTCCCTTGG - Intronic
1004219362 6:13732441-13732463 ATAAGGCTACTCAGCACACTAGG - Intergenic
1006081728 6:31571915-31571937 ATATAACATCTCTGCACCCTTGG - Intergenic
1006424946 6:33958139-33958161 ATGGGGCCTCTCACCATCCTAGG - Intergenic
1011667993 6:89654164-89654186 GTCGGGCACCACAGCACCCTTGG - Exonic
1016619701 6:146093784-146093806 ATAGGGCATGTAAGCACCTAAGG - Intronic
1016926617 6:149356573-149356595 AAGGGGCAGCTCAGCTCCCTCGG + Intronic
1017647074 6:156549051-156549073 ATAGGGCAGCTCGGCACACCGGG + Intergenic
1018291849 6:162299171-162299193 ATCAGGCATCTCAGCCCCTTCGG + Intronic
1021603368 7:22386829-22386851 ATAGTGCAGCTCAGCATCCCAGG + Intergenic
1022206114 7:28165372-28165394 TTAGGGCTTCTCAGGTCCCTAGG + Intronic
1025866846 7:65390444-65390466 AGAGGGCATCCCATCACCGTGGG - Intronic
1032042383 7:128574059-128574081 ATGGGGCAGGTCAGCAGCCTGGG + Intergenic
1034859180 7:154581532-154581554 ACAGGGCACCCCAGCTCCCTGGG - Intronic
1036444144 8:8807061-8807083 ATATGGCACCTGAGCACGCTGGG + Intronic
1036462383 8:8964840-8964862 ATATGGCACCTGAGCACGCTGGG - Intergenic
1045115258 8:98973940-98973962 ATAGGGCTTCTCTGCGACCTGGG - Intergenic
1045225251 8:100237863-100237885 AAATGGAAGCTCAGCACCCTAGG - Intronic
1049929176 9:439569-439591 AAAGGTTATCTCAGCTCCCTTGG - Intronic
1051444855 9:17129318-17129340 ATAGGAAATGTTAGCACCCTAGG - Intergenic
1055891003 9:81123101-81123123 CCTGGGCATCTCTGCACCCTTGG - Intergenic
1055977275 9:81967671-81967693 ATAGGGCATCACAAAAGCCTGGG + Intergenic
1057704034 9:97385312-97385334 ACACGGCATAGCAGCACCCTTGG - Intergenic
1060271199 9:122143257-122143279 ATAAGTCTTCTCAGCTCCCTGGG - Intergenic
1060416628 9:123435251-123435273 AAATGCCTTCTCAGCACCCTTGG - Intronic
1060730431 9:126033617-126033639 ATGTGCCAACTCAGCACCCTCGG - Intergenic
1060942395 9:127550355-127550377 ACAGTGCTTTTCAGCACCCTAGG - Intronic
1061509944 9:131054296-131054318 CCAGGGCATCCCAGCACCCTTGG - Intronic
1203371342 Un_KI270442v1:308558-308580 ATAGGCCAGCTCAGCACAGTGGG - Intergenic
1186078181 X:5903193-5903215 ATAGGGGACCTCATCACCATGGG + Exonic
1190761266 X:53440128-53440150 AAAGGGCATCGCACCATCCTGGG - Intergenic
1192416138 X:70982389-70982411 ACAGGGCCTCTCAGTAGCCTTGG + Intergenic