ID: 1164045557

View in Genome Browser
Species Human (GRCh38)
Location 19:21536567-21536589
Sequence CCTTTCCAGTGTAAAAAATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164045557 Original CRISPR CCTTTCCAGTGTAAAAAATG TGG Exonic
908393252 1:63702598-63702620 CCTTTCCAAGGTATAATATGTGG + Intergenic
909593663 1:77380340-77380362 CCTTTCTAGTCTCAAAAATGAGG - Intronic
910097770 1:83543219-83543241 ATTTTCCAGTTTAAAAAATAGGG - Intergenic
910269619 1:85379837-85379859 CCTTTCCAGTGGTAGAAACGTGG - Intronic
911455047 1:98111936-98111958 CCTTTCCAGTTTGATCAATGAGG - Intergenic
912038871 1:105359025-105359047 CCTTTCCAGTTTTAAACATGAGG - Intergenic
912045938 1:105457365-105457387 CCTTTCCAGGATTAAAAATGCGG + Intergenic
912428352 1:109613942-109613964 CCTTTCCTGGGGGAAAAATGAGG + Exonic
912915343 1:113809298-113809320 CTTTTCCTGTCTATAAAATGGGG - Intronic
912986716 1:114440743-114440765 CATTTTCAATGTAAAAAAAGGGG + Intronic
916757000 1:167780892-167780914 CTTTTACTGTTTAAAAAATGTGG - Intronic
917631073 1:176891983-176892005 CTTTTCCAGTGGTAGAAATGTGG + Intronic
917913935 1:179681540-179681562 TCATTCCAGTGTATAAATTGGGG + Intronic
919070415 1:192748592-192748614 TGTTTCCAGGGTAAAAAATTTGG + Intergenic
922444172 1:225682539-225682561 CCTTTCTCATGTATAAAATGTGG - Intergenic
922539909 1:226410778-226410800 CCTTTCCAGAATAAATATTGTGG - Intergenic
922687510 1:227655040-227655062 CCTTACAAGTGTGAAGAATGTGG + Exonic
922687568 1:227655796-227655818 CCTGACAAATGTAAAAAATGTGG + Exonic
924596964 1:245454798-245454820 CCTTTCTATTGTAAGAATTGTGG + Intronic
924761143 1:246987862-246987884 CCGTACCAATGTAAAAAATGTGG - Exonic
1064221617 10:13445684-13445706 CGTTTCCAGTGAGAAAACTGAGG - Intronic
1064841099 10:19592852-19592874 CCTTTTCTTTTTAAAAAATGAGG - Intronic
1065459278 10:25939421-25939443 CCTTTCTAATGTAAAATTTGAGG + Intronic
1066517870 10:36184091-36184113 ACTGTCCTGTGTATAAAATGTGG + Intergenic
1066973268 10:42337933-42337955 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1070556226 10:77529722-77529744 CCTCTCCAGGGAAAAGAATGAGG + Intronic
1070681159 10:78450057-78450079 CCCTTCCACTTTAATAAATGAGG - Intergenic
1070936313 10:80299089-80299111 CTTTTCGAATGTAAAGAATGTGG + Intergenic
1070960914 10:80499676-80499698 GCTTTCCCATGTGAAAAATGAGG + Intronic
1071124155 10:82314946-82314968 AGTTTATAGTGTAAAAAATGAGG - Intronic
1074049286 10:109867625-109867647 CCTTTACAGTGTCAAGAACGAGG + Intronic
1074068661 10:110043571-110043593 CTTATGCAGTGGAAAAAATGTGG - Intronic
1075104764 10:119531645-119531667 GCTTCCCAGTCTATAAAATGAGG - Intronic
1075359622 10:121819057-121819079 AATTTCCAGTCTAAACAATGGGG + Intronic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1077573657 11:3360259-3360281 CCTTTCAAATGTCAAGAATGTGG - Exonic
1078976405 11:16483662-16483684 CATTTGCAATGAAAAAAATGAGG + Intronic
1079357937 11:19745514-19745536 CCTTTCCAGTGTCAAAAGCCAGG - Intronic
1080074422 11:28132211-28132233 CCTTTACAGGGCAAAAAAAGAGG - Intronic
1080713423 11:34772514-34772536 CCATTCCAAGGTAAAAGATGAGG + Intergenic
1081574961 11:44313324-44313346 CCATTCCTGTCTAAAAAATGAGG + Intergenic
1083536305 11:63469776-63469798 CCTTTCAAATGTAAAGAATACGG + Intronic
1083651200 11:64205899-64205921 CCTTTCCAGTGAACACACTGGGG - Intergenic
1084521347 11:69664937-69664959 CATTCCCAGTGTAAAAGCTGAGG + Intronic
1086982270 11:93211333-93211355 CCTGTCCATTGTAAAATGTGGGG - Intergenic
1091520120 12:1230640-1230662 CCTATCCATTGTTAAAAGTGGGG + Intronic
1091971855 12:4794116-4794138 CCTTTCCTGTGCCCAAAATGTGG + Intronic
1092627275 12:10340136-10340158 TCTCTCAAGTTTAAAAAATGAGG - Intergenic
1093256947 12:16880390-16880412 TCTTTCCATTTTAAAAAATCTGG + Intergenic
1095253221 12:40002967-40002989 CCTTTCCAGTGTACAAATCATGG - Intronic
1095714364 12:45326107-45326129 CCTTACCAGGGTCTAAAATGTGG + Intronic
1096298325 12:50403102-50403124 TCATTCAAGTGTAAATAATGTGG + Intronic
1096984978 12:55750287-55750309 CCTTGCCAGTGGAAGAAAGGAGG - Exonic
1097971030 12:65633452-65633474 CATTTCCAGTGTAAAGGCTGGGG + Intergenic
1098107449 12:67084308-67084330 TCTTTCCAATTTAAAAAAGGGGG - Intergenic
1098434955 12:70458935-70458957 CTTTTTCAGTTAAAAAAATGAGG - Intergenic
1098483539 12:70994705-70994727 CATTTCCAGTGGATATAATGTGG + Intergenic
1098664347 12:73141937-73141959 ACTTTCCAGCTTAAAAAATATGG + Intergenic
1099209828 12:79770827-79770849 CTTTTCCAGTGAAAAATGTGTGG - Intergenic
1100047455 12:90399919-90399941 CCTCTCCAGGGTATAAAATCCGG - Intergenic
1100497634 12:95140674-95140696 CCTTTCCAGTTTTGAAAAAGAGG - Intronic
1101156839 12:101935810-101935832 ACTTACCAGTGAGAAAAATGAGG - Intronic
1101279906 12:103242349-103242371 AGTTTCCATTGTAAAAATTGAGG - Intronic
1102844291 12:116162036-116162058 CCTTTCAAGTGTTAACAAAGTGG + Intronic
1105228887 13:18469658-18469680 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1107005352 13:35603501-35603523 TCTTTCCTGTATAAAATATGTGG - Intronic
1107442031 13:40436488-40436510 CTTTCCCAGTGTGATAAATGAGG - Intergenic
1108504070 13:51094305-51094327 CCTTTTCAGTGCAATAAATGAGG + Intergenic
1108766597 13:53638176-53638198 CTTTTCCCGTGAAAAGAATGTGG + Intergenic
1111090303 13:83437834-83437856 CCTCTGTAGTGTATAAAATGAGG - Intergenic
1111238789 13:85446960-85446982 TCTTTCCACTTTAAAAAATATGG - Intergenic
1111504983 13:89176045-89176067 CCATGCCAGTGTTTAAAATGTGG + Intergenic
1112213739 13:97408383-97408405 CCCTTCCACTGAAAAAAAGGTGG + Intergenic
1112856277 13:103773618-103773640 TCTTTCCAGAGCAAAGAATGGGG - Intergenic
1113208632 13:107947793-107947815 TCTGTCCAGTGGCAAAAATGGGG - Intergenic
1113549758 13:111183851-111183873 TCTCTCCTGTGTAAAAGATGAGG + Intronic
1114013169 14:18396634-18396656 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1114811236 14:25902407-25902429 CCTTCCCAGTGTAAAGTAAGAGG - Intergenic
1115073788 14:29360769-29360791 CATTTCCAGCTTAAAATATGTGG + Intergenic
1115254359 14:31383078-31383100 CCTTTTCACTGTACAAAAGGAGG + Intronic
1116824505 14:49659004-49659026 ACTTTCCAGTGGACAAGATGTGG + Intronic
1117645495 14:57847358-57847380 CCTTACCAGTATAAGAAAAGTGG - Intronic
1118059707 14:62122171-62122193 ACTTTCCAAGGTAAAAGATGGGG + Intergenic
1118703053 14:68453506-68453528 GCTTTCCAGGGTGAAAAAGGGGG - Intronic
1119319201 14:73719308-73719330 ACTTTCCCCTGTAAAAAATGTGG - Exonic
1120349462 14:83334784-83334806 CCCTTCCAGAGAAAATAATGGGG - Intergenic
1122417183 14:101556025-101556047 CCTCTCCAGTGAAGAAACTGAGG + Intergenic
1123502348 15:20900716-20900738 CCTTTCAAATGTGAAGAATGTGG - Intergenic
1123559598 15:21474400-21474422 CCTTTCAAATGTGAAGAATGTGG - Intergenic
1123559631 15:21474905-21474927 CCTATCAAGTGTAAGGAATGTGG - Intergenic
1123595834 15:21911697-21911719 CCTTTCAAATGTGAAGAATGTGG - Intergenic
1125195921 15:37045884-37045906 CCTTTTGAGTGTGAAAAAGGTGG - Intronic
1125820003 15:42621167-42621189 ACTTTACAGTGAAAAAAATCTGG - Intronic
1126223489 15:46242400-46242422 CATATTGAGTGTAAAAAATGTGG + Intergenic
1127160383 15:56177324-56177346 CCTTTCCCTTTTAAAAATTGTGG + Intronic
1128369708 15:67031641-67031663 CCTCTCCAGGGGAAACAATGAGG + Intergenic
1129448519 15:75635751-75635773 CCTTTTCACATTAAAAAATGTGG + Intergenic
1130149675 15:81301875-81301897 GCTGTCCATTGTAAACAATGTGG + Intronic
1131324168 15:91426568-91426590 CCTTTCCAGTTAAATAACTGAGG - Intergenic
1202967943 15_KI270727v1_random:201560-201582 CCTTTCAAATGTGAAGAATGTGG - Intergenic
1133878141 16:9754444-9754466 CCTTCCCAGTGAAAAATTTGGGG + Intronic
1136644710 16:31602232-31602254 CCTTACAAATGTAAAGAATGTGG - Intergenic
1136660462 16:31755042-31755064 CCTTACAAATGTAAAGAATGTGG + Intronic
1136934538 16:34447513-34447535 CCTTTCCAGAGTAAAATCTTAGG - Intergenic
1136970034 16:34964301-34964323 CCTTTCCAGAGTAAAATCTTAGG + Intergenic
1137849344 16:51723204-51723226 CCTTTCCTGATTAAAACATGAGG - Intergenic
1138248308 16:55483362-55483384 GCTTTCCAATCTACAAAATGGGG + Intronic
1138986762 16:62338398-62338420 CATTTTCAGTGTAGAAAGTGAGG + Intergenic
1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG + Exonic
1140262448 16:73392072-73392094 ACTTCCCACTGTGAAAAATGAGG - Intergenic
1140773413 16:78227380-78227402 CCTTTCCATTGGAACACATGGGG + Intronic
1142296734 16:89228554-89228576 CCTTTCTAATGTAAAGAATGTGG + Exonic
1143627660 17:8120491-8120513 CATTTCCAGTCTAAAAGATGTGG - Intergenic
1144487059 17:15675473-15675495 CCCTACAAGTGTAAAGAATGTGG + Intronic
1144597139 17:16580044-16580066 CATTTACAGTTTAGAAAATGGGG - Intergenic
1144913969 17:18706843-18706865 CCCTACAAGTGTAAAGAATGTGG - Intronic
1145819729 17:27822954-27822976 CCTTTACAGGGTGAAAAAAGAGG + Intronic
1146087417 17:29842737-29842759 CCCTTCCAAAGTAAAAAATAAGG + Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1147345632 17:39791553-39791575 CCATTCCAGTGTAATCAGTGTGG - Exonic
1147664085 17:42134724-42134746 CCTTTCCTGTGGAAGACATGAGG - Intronic
1147862006 17:43529271-43529293 CCTTGGCAGAGGAAAAAATGGGG + Intronic
1149182289 17:53953565-53953587 CCTTTCCAATGTAATGAGTGTGG + Intergenic
1149343439 17:55710399-55710421 CCTTTCCTGTGTAAAATAAGAGG - Intergenic
1151452836 17:74209576-74209598 CTGTTCCCCTGTAAAAAATGGGG - Intronic
1154407251 18:14104975-14104997 CCTTTCAAATGTAAAGAATGTGG - Exonic
1154407276 18:14105311-14105333 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1154407299 18:14105563-14105585 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1154419569 18:14213765-14213787 CATTTGCGATGTAAAAAATGGGG + Intergenic
1154524566 18:15270467-15270489 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1155102396 18:22624898-22624920 CCTTCACAGAGTTAAAAATGGGG + Intergenic
1155552851 18:26984171-26984193 CTTTTCCAATATATAAAATGGGG + Intronic
1156240171 18:35246143-35246165 CCTTATCAGTGTAATGAATGTGG + Exonic
1157247904 18:46070453-46070475 CCTTGCCAGTGCTAAAACTGTGG + Intronic
1157287381 18:46386188-46386210 CCTCGCCAGTGTAAGAAATGAGG - Intronic
1158416237 18:57251838-57251860 CTTTTCCAGTGAAAGAAATCAGG - Intergenic
1160285516 18:77539177-77539199 CATTTCCAGTGTAAGAAAACTGG + Intergenic
1161185629 19:2917708-2917730 CCTTATGAGTGTAAACAATGTGG + Exonic
1161185644 19:2917876-2917898 CCTTATGAGTGTAAACAATGTGG + Exonic
1161185660 19:2918044-2918066 CCTTATGAGTGTAAACAATGTGG + Exonic
1162284003 19:9724297-9724319 CCCTATCAGTGTAACAAATGTGG - Intergenic
1162616696 19:11807181-11807203 CCTTACCAATGTAAGGAATGTGG + Exonic
1162641728 19:12015584-12015606 CCTTACGAGTGTAAGCAATGTGG - Exonic
1162665643 19:12209338-12209360 CCTATAAAGTGTAAAGAATGTGG + Intergenic
1162669894 19:12247758-12247780 CCCTTTGAGTGTAAAAAATGTGG - Intronic
1162669934 19:12248262-12248284 CCCTTTAAGTGTAAAGAATGTGG - Intronic
1162694646 19:12464225-12464247 CCTTATGAGTGTAAACAATGTGG - Exonic
1162709389 19:12580552-12580574 CCCTTTCAGTGTAGACAATGTGG - Exonic
1162715429 19:12628676-12628698 CCCTACGAATGTAAAAAATGTGG + Exonic
1163853334 19:19679743-19679765 CCTTACAAATGTAAACAATGTGG + Exonic
1163857057 19:19711671-19711693 CCTTTTGAGTGTAAGCAATGTGG - Exonic
1163882099 19:19933973-19933995 CCATACAAGTGTAATAAATGTGG + Exonic
1163902594 19:20118068-20118090 CCTTTCAAATGTATAGAATGTGG + Exonic
1163911446 19:20198007-20198029 CCTTACAAATGTAAAGAATGTGG + Exonic
1163946823 19:20544911-20544933 CCCTTCAAGTGTGAAGAATGTGG - Exonic
1163946895 19:20545667-20545689 CCTTTCAAATGTATAGAATGTGG - Exonic
1163960946 19:20691632-20691654 CCTTTCAAATGTATAGAATGTGG + Intronic
1163961237 19:20695512-20695534 CCTTTCAAATGTATAGAATGTGG + Intronic
1163985759 19:20949031-20949053 CCTTTCAAATGTACAAAATGTGG + Exonic
1163985800 19:20949535-20949557 CCCTACAAATGTAAAAAATGTGG + Exonic
1163985815 19:20949703-20949725 CCTTACAAATGTAAAGAATGTGG + Exonic
1164009155 19:21182910-21182932 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164020094 19:21294445-21294467 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164028980 19:21383153-21383175 CCTTTCAAATGTAAAAAATGTGG + Intergenic
1164032746 19:21423200-21423222 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1164141539 19:22471245-22471267 CCTTTCAAATGTAAAGAATGTGG + Intronic
1164184933 19:22857405-22857427 TCTTTCAAATGTAAAGAATGTGG + Intergenic
1164184987 19:22858161-22858183 CCTTACAAATGTAAACAATGTGG + Intergenic
1164215775 19:23145558-23145580 CCTTTCAAATGTAAAGAATGTGG + Exonic
1164215782 19:23145723-23145745 CCTTACAAATGTAAAGAATGTGG + Exonic
1164223798 19:23223718-23223740 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164238424 19:23359812-23359834 CCTTACAAGTGTGAAGAATGTGG - Exonic
1164238489 19:23360652-23360674 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238494 19:23360736-23360758 CCTTACAAGTGTGAAGAATGTGG - Exonic
1164238552 19:23361576-23361598 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238557 19:23361660-23361682 CCTTACAAGTGTGAAGAATGTGG - Exonic
1164252433 19:23492297-23492319 CCTTACAAGTGTGAAGAATGTGG - Intergenic
1164252464 19:23492717-23492739 CCTTACAAGTGTGAAGAATGTGG - Intergenic
1164264155 19:23596408-23596430 TCTTTCAAATGTAAATAATGTGG + Intronic
1164269096 19:23654400-23654422 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164278253 19:23743763-23743785 CCCTACCAATGTGAAAAATGTGG - Exonic
1164278295 19:23744267-23744289 CCCTACCAGTGTGAAAAATGTGG - Exonic
1164297997 19:23932882-23932904 CCTTACAAGTGTGAAGAATGTGG + Exonic
1164298045 19:23933386-23933408 CCTTACAAGTGTGAAGAATGCGG + Exonic
1164298079 19:23933806-23933828 CCTTACAAGTGTGAAGAATGTGG + Exonic
1164298102 19:23934135-23934157 CCTTACAAGTGTGAAGAATGTGG + Exonic
1164319305 19:24126877-24126899 CCTTACAAGTGTGAAGAATGTGG + Exonic
1164319331 19:24127297-24127319 CCTTACAAGTGTGAAGAATGTGG + Exonic
1165299330 19:34958572-34958594 CCTTACAAGTGTAACGAATGTGG - Exonic
1165506734 19:36236735-36236757 CCTTTTGAGTGTAAAGATTGCGG + Exonic
1165582263 19:36877179-36877201 CCTTTTGAATGTAAAGAATGTGG + Exonic
1165589034 19:36949898-36949920 CCTTACGAATGTAAAGAATGTGG + Exonic
1165670010 19:37669026-37669048 CCCTATCAGTGTAAAGAATGTGG - Exonic
1165684170 19:37803864-37803886 CCCTTTCAATGTAACAAATGTGG + Intronic
1165822769 19:38686931-38686953 CCATTCCAGTCTAACAAATCTGG + Intronic
1166576785 19:43848309-43848331 CCTTTCAAATGTAAGGAATGTGG + Exonic
1166597873 19:44066519-44066541 CCTTTCAAATGTGAACAATGTGG + Exonic
1166607409 19:44157043-44157065 CCTTACAAGTGTGAAGAATGTGG + Exonic
1166628874 19:44387532-44387554 CCTTTCCCATGTAATAACTGTGG - Exonic
1167835581 19:52065990-52066012 CCTTTCCAGTGTAACGAATGCGG - Exonic
1167835596 19:52066158-52066180 CCTCTCCATTGTAATAAATGTGG - Exonic
1167845073 19:52155920-52155942 CCTTTCCAATGTAATGAATGTGG - Exonic
1167876312 19:52416158-52416180 CCTTACAAATGTAATAAATGTGG + Exonic
1167887256 19:52511237-52511259 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887263 19:52511321-52511343 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887271 19:52511405-52511427 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887285 19:52511573-52511595 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887303 19:52511909-52511931 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887335 19:52512422-52512444 TCTTCCGAGTGTAATAAATGTGG + Intergenic
1167892658 19:52553772-52553794 CCTTACAAGTGTAAAGAGTGTGG + Exonic
1167892672 19:52553940-52553962 CCTTACAAGTGTAATGAATGTGG + Exonic
1167892717 19:52554612-52554634 CCTTACAAGTGTAATGAATGTGG + Exonic
1167892766 19:52555368-52555390 CCTTACAAGTGTAATGAATGTGG + Exonic
1167896095 19:52582948-52582970 CCTTACAAGTGTAATGAATGTGG + Exonic
1167896119 19:52583368-52583390 CCTTACAAGTGTAATGAATGTGG + Exonic
1167896157 19:52583868-52583890 TCTTACAAGTGTAATAAATGTGG + Exonic
1167897891 19:52596111-52596133 CCTTTCCAATGTAATGAGTGTGG + Intronic
1167897961 19:52597084-52597106 TCTTACAAGTGTAATAAATGTGG + Intronic
1167899975 19:52613177-52613199 CCTTTCAAATGTAATGAATGTGG - Exonic
1167900027 19:52613849-52613871 CCTTACGAATGTAACAAATGTGG - Exonic
1167905082 19:52653044-52653066 CCTTACAAGTGTAATGAATGTGG - Intronic
1167905146 19:52653884-52653906 CCTTTCCAATGTAATGAGTGTGG - Intronic
1167911336 19:52704587-52704609 TCTTACAAGTGTAATAAATGTGG - Exonic
1167911365 19:52705004-52705026 CCTTACAAGTGTAATGAATGTGG - Exonic
1167911408 19:52705592-52705614 CCTTACAAGTGTAATGAATGTGG - Exonic
1167911446 19:52706177-52706199 CCTTACAAGTGTAAAGAGTGTGG - Exonic
1167918958 19:52765909-52765931 CCTTACAAGTGTAATGAATGTGG - Exonic
1167919003 19:52766497-52766519 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923104 19:52799839-52799861 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923155 19:52800511-52800533 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923172 19:52800763-52800785 CCTTACAAGTGTAATGAATGTGG - Exonic
1167928153 19:52839853-52839875 TCTTACAAGTGTAATAAATGTGG - Exonic
1167935808 19:52906571-52906593 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167935831 19:52906991-52907013 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167935852 19:52907327-52907349 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167935862 19:52907495-52907517 CCTTACATGTGTAATAAATGTGG - Intergenic
1167938746 19:52928558-52928580 CCTTGCAAGTGTAATGAATGTGG - Exonic
1167941542 19:52949979-52950001 CCTTACAAGTGTAATGAATGTGG - Exonic
1167941574 19:52950399-52950421 CCATACAAGTGTAATAAATGTGG - Exonic
1167943722 19:52969675-52969697 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167956458 19:53068822-53068844 CCTTACAAGTGTAATGAATGTGG - Exonic
1167956486 19:53069158-53069180 CCTTACAAGTGTAATGAATGTGG - Exonic
1167965380 19:53140768-53140790 CCTTACCAGTGTAATGAATGTGG - Exonic
1167968187 19:53165855-53165877 CCTTACCAGTGTAATAAGTGTGG - Exonic
1167987316 19:53329449-53329471 TCTTACAAGTGTAATAAATGTGG + Intergenic
1167990094 19:53352323-53352345 CCTTACCAGTGTAATGAGTGTGG + Exonic
1167990152 19:53353079-53353101 CCTTACAAGTGTAATGAATGTGG + Exonic
1167990172 19:53353331-53353353 CCTTACAAGTGTAATAAATGTGG + Exonic
1167990183 19:53353499-53353521 CCTTACAAGTGTAATGAATGTGG + Exonic
1167993584 19:53382979-53383001 CCTTACAAGTGTAATGAATGTGG + Exonic
1167993587 19:53383063-53383085 GCTTGCAAGTGTAATAAATGTGG + Exonic
1168002174 19:53457068-53457090 CCTTACCAGTGTAATGAGTGTGG + Exonic
1168006320 19:53491292-53491314 CCTTTCAAGTGTAATGAGTGTGG + Exonic
1168006338 19:53491460-53491482 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006355 19:53491712-53491734 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006362 19:53491796-53491818 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006367 19:53491880-53491902 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006373 19:53491964-53491986 CCTTACAAGTGTAATGAATGTGG + Exonic
1168016442 19:53577368-53577390 CCTTACGAGTGTAAAGACTGTGG + Exonic
1168051167 19:53831010-53831032 ACTTTCCAGTTTAAAAAAAGAGG + Intergenic
1168460693 19:56554547-56554569 CCTTTTAAGTGTAAAGAGTGCGG + Exonic
1168541276 19:57212457-57212479 CCTTTCGAGTGCAAAGAGTGTGG + Exonic
1168546423 19:57254179-57254201 CCTTTCGAGTGCAAAGAGTGTGG + Exonic
1168550803 19:57291712-57291734 CCTTTTGAGTGCAAAGAATGTGG + Exonic
925630412 2:5886836-5886858 GCTTTGCAATGTAAAAATTGTGG + Intergenic
925786531 2:7436557-7436579 CCTTTCCACTGTAAAATGAGAGG - Intergenic
926653982 2:15379054-15379076 CCTTTCTAGTGTTAAATAAGAGG + Intronic
926988818 2:18654163-18654185 ACTTTACTTTGTAAAAAATGAGG + Intergenic
928443671 2:31314435-31314457 CTTTACCAGTGAAGAAAATGAGG - Intergenic
928847178 2:35690542-35690564 CCTTTTCAGTGAAAAAAAGCAGG + Intergenic
929217768 2:39434588-39434610 CATTTCCAGTGGAGAAACTGAGG - Intronic
930296068 2:49555641-49555663 CCTTCCCAGTCTGTAAAATGAGG - Intergenic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
931068135 2:58611197-58611219 CCTTTCCCATCTGAAAAATGGGG - Intergenic
931871769 2:66468379-66468401 CCTGTCCAGACTCAAAAATGTGG - Intronic
932515343 2:72341660-72341682 TCTATCCACTGTTAAAAATGTGG - Intronic
934497672 2:94823517-94823539 CATTTGCGATGTAAAAAATGGGG - Intergenic
934537686 2:95149436-95149458 CCTTACAAATGTAATAAATGTGG - Exonic
936704857 2:115059950-115059972 TATTTCCAGTTTAAAACATGAGG + Intronic
937817731 2:126271945-126271967 GTTTTCCTGTCTAAAAAATGGGG + Intergenic
938523752 2:132102580-132102602 CCTTTCAAATGTAAAGAATGTGG + Intergenic
938681388 2:133694495-133694517 CCCTTGCAATGAAAAAAATGGGG - Intergenic
943277946 2:185892136-185892158 CATTTCCAGTGAATAAAATATGG - Intergenic
943490389 2:188547149-188547171 CCATTCCAGTGAAAAATAAGAGG + Intronic
943672959 2:190683492-190683514 TCTTTCCAGTGTAAAACAATAGG + Intronic
944607241 2:201363266-201363288 CCTTTCCTGTGTATAGATTGTGG + Intergenic
944785036 2:203061544-203061566 CCTTAGGAATGTAAAAAATGCGG - Intronic
945745651 2:213717840-213717862 ACTTTCCATTTTACAAAATGGGG + Intronic
946511222 2:220358674-220358696 CTGTTCCAGTGTAGAAAAGGAGG + Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
946806783 2:223478545-223478567 TCTTTCCAGTCTACATAATGGGG - Intergenic
946991702 2:225338308-225338330 CCTTCCCAGTGTGGATAATGAGG - Intergenic
1169098622 20:2926131-2926153 CCTCTCCAGTGTGAAAAAATGGG + Intronic
1170449118 20:16463493-16463515 CCTTTCCAGTTAGAAAAATCAGG - Intronic
1170742807 20:19072929-19072951 GTTTTCCAGTCTAAAAAAAGGGG + Intergenic
1172178032 20:32984454-32984476 CCTATCTAGTGTAAAAAGTGGGG + Intronic
1173776406 20:45711464-45711486 CCTTTGCTGTGCAGAAAATGTGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175322369 20:58098295-58098317 ACTTCCCAGAGTTAAAAATGGGG - Intergenic
1175425075 20:58859050-58859072 GTTTTCCATTGTAAATAATGGGG - Intronic
1176772878 21:13098019-13098041 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1176853734 21:13945531-13945553 CATTTGCAATGTAAAAAATGGGG - Intergenic
1176864517 21:14037932-14037954 CATATTGAGTGTAAAAAATGTGG + Intergenic
1177142502 21:17372628-17372650 CAGTTCCAGGGGAAAAAATGAGG - Intergenic
1177185557 21:17790338-17790360 CCTTACCAGTGTAAACACTAAGG + Exonic
1178970487 21:37171822-37171844 TCTTTCAAGTGTAAAAAAGCAGG - Intronic
1179212466 21:39336958-39336980 CTTTTCCAGTGGAAAAAAGTAGG - Intergenic
1179358878 21:40687062-40687084 ACTTTCCAGTGTTTAAAATGAGG + Intronic
1180437667 22:15327449-15327471 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1180520517 22:16197736-16197758 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1180537319 22:16404459-16404481 CCTTACCAGTGAAAAAGCTGGGG - Intergenic
1181566904 22:23744368-23744390 CCTTATCAGTGTAAGGAATGTGG - Exonic
1181776969 22:25166733-25166755 TTTTTCCAGTGTGAAAACTGAGG + Intronic
1183037421 22:35150738-35150760 ACTGTCCAGTGTCAAAGATGTGG + Intergenic
1183713122 22:39518283-39518305 CCTTTTCAGTGTCAAAATTGGGG + Intergenic
949662746 3:6299394-6299416 CCTTTACAATGTCAAATATGAGG + Intergenic
952288331 3:31989932-31989954 CCTTACAAGTGTAATGAATGTGG + Exonic
952288357 3:31990352-31990374 TCTTACAAGTGTAATAAATGTGG + Exonic
952288377 3:31990604-31990626 CCTTACAAGTGTAATGAATGTGG + Exonic
953030918 3:39179216-39179238 CATTTCCAGAATAAAGAATGGGG + Intergenic
953206560 3:40835496-40835518 CCATGGCAGTCTAAAAAATGTGG - Intergenic
953393587 3:42548747-42548769 CTTTTGGAGTGAAAAAAATGAGG + Intronic
953633647 3:44642823-44642845 CCTTACAAGTGTAAAGAATGTGG + Exonic
953638507 3:44684211-44684233 CCTTTCCTATGTAATGAATGCGG - Intergenic
953643831 3:44734902-44734924 CCTTTTAAGTGTAATGAATGTGG + Exonic
954845034 3:53547944-53547966 CCTTTCCAGCGTGAGCAATGGGG + Intronic
955679808 3:61488620-61488642 CTTTTCCAGTGAGAAAACTGAGG + Intergenic
957568482 3:81915308-81915330 CATTTGCAGGGTAAAACATGGGG + Intergenic
958877010 3:99627929-99627951 CCTTTCCCATATAAAAAGTGGGG + Intergenic
959765239 3:110018969-110018991 CCTTTCAAGTATGAAATATGGGG - Intergenic
960025927 3:113009296-113009318 CCTTTTGAGTGTAAGAAATTTGG - Intronic
960534745 3:118803369-118803391 TCTTTCCTCTGTAAAAAATGGGG - Intergenic
961839920 3:129700803-129700825 CTTTTCCAGTGTTTAAAATGTGG - Intronic
962232250 3:133675945-133675967 CGTTTACAGTGAAAGAAATGGGG + Intergenic
965113345 3:164455312-164455334 GCTTTCTAGTTTATAAAATGAGG + Intergenic
965342743 3:167510703-167510725 TCTTTCCAGGTTAAAAAATTGGG - Intronic
965928730 3:174015681-174015703 TTTCTCCATTGTAAAAAATGGGG - Intronic
968416573 4:441686-441708 CCATACAAGTGTAAAGAATGTGG - Exonic
968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG + Intronic
969167690 4:5330999-5331021 CCTTTGCTATGTAAGAAATGAGG + Intronic
970989143 4:22192298-22192320 AATTTCCAGGGTAAAAGATGAGG + Intergenic
972348935 4:38217907-38217929 CCTTTCCAGAGTAAAAGAACAGG - Intergenic
972423900 4:38914850-38914872 CGTTTCCTGTGTAAGACATGGGG - Intronic
973220154 4:47716929-47716951 ACTTTCCATTGTAATGAATGTGG - Intronic
974430117 4:61785831-61785853 CATTTCCAGAGTAAAAACTTTGG + Intronic
974672565 4:65051642-65051664 ACTTTTGAATGTAAAAAATGAGG - Intergenic
975199256 4:71566017-71566039 CCTTCCCAGTGTTAACAGTGTGG - Intronic
977118395 4:93063577-93063599 GCTGTCAAGTGTAAAAATTGTGG + Intronic
977806709 4:101308303-101308325 CCTTTCCAGTTTTAAAATTTAGG - Intronic
978082677 4:104613742-104613764 CCTCTCCAGTGCTGAAAATGGGG + Intergenic
978599948 4:110417353-110417375 CCTTACAAGTGTAATAAGTGTGG + Intronic
979646158 4:123071929-123071951 CCTTTCAACTGTAATAAATAAGG + Intronic
980052348 4:128051218-128051240 CCTTGCCACTATAAAACATGAGG - Intergenic
980057348 4:128091041-128091063 CGTTTCCAGTGTGAGAAGTGAGG + Exonic
980860452 4:138493527-138493549 CCATTCCAGAGTTATAAATGTGG - Intergenic
981545846 4:145892370-145892392 CCTTTCCAGTGTCCAATATGTGG - Exonic
981918640 4:150062347-150062369 CCTTTTCCGTTTAAAATATGAGG - Intergenic
984241292 4:177222858-177222880 GTTTTCCAGTCTATAAAATGTGG + Intergenic
984263132 4:177465610-177465632 GTTTTTCAGTGAAAAAAATGAGG + Intergenic
984678094 4:182573116-182573138 CTTTTCTAATGTAGAAAATGTGG - Intronic
985379665 4:189379380-189379402 CCTGTCCAGGGTCAAGAATGTGG - Intergenic
987779553 5:22416511-22416533 CCTTTCTGGTTTGAAAAATGGGG - Intronic
988641229 5:33042234-33042256 CCTTTCCAGTGGACCAACTGTGG - Intergenic
989300633 5:39888178-39888200 CCTTTCCACTGGAAATAATTGGG - Intergenic
990344520 5:54858375-54858397 CCTTTCGTATGTAAAGAATGCGG + Intergenic
990524361 5:56610198-56610220 CCTCTCCAGTGGAATAAAAGAGG + Intergenic
990693621 5:58390788-58390810 TCTTTCCATGGTAAATAATGAGG - Intergenic
993154300 5:84202867-84202889 CCATTCCACTGGAAGAAATGAGG + Intronic
993633473 5:90315887-90315909 CCTTGACAGTGTAAAAACTGAGG - Intergenic
993848751 5:92979074-92979096 CCTTTCTATTGTAAAAGGTGTGG - Intergenic
994132329 5:96244611-96244633 GCTTTCCCGTGTATAAAATGGGG - Intergenic
994428446 5:99625063-99625085 CCTGTCCAATGCTAAAAATGGGG + Intergenic
994587540 5:101729030-101729052 GGTTTCCAGTGTAATAAATGTGG + Intergenic
995002544 5:107152043-107152065 AGTTTCCAGTGTAAAAAGAGGGG - Intergenic
995851291 5:116548637-116548659 CCTTTCCAATGGGAAAATTGAGG + Intronic
995963918 5:117880995-117881017 CATTTGCAATGTAAACAATGGGG + Intergenic
996330752 5:122325818-122325840 CCTTGCAAGTGTTAAAGATGGGG + Intronic
996816328 5:127576953-127576975 TCTATCCATTGTAAAAAGTGGGG - Intergenic
999242248 5:150134664-150134686 CCTTTACAGTTTACAAAGTGTGG - Intronic
999427012 5:151497142-151497164 AATTTCCAGTTTAAAAAAAGTGG + Intergenic
999977929 5:156930315-156930337 TATTGCCAGTGAAAAAAATGAGG + Intronic
1000257752 5:159557116-159557138 CCTTCCCAGTGTCTACAATGTGG + Intergenic
1000628896 5:163569587-163569609 CCTTTCAAGTGTAAAAAGGATGG + Intergenic
1001109084 5:168880667-168880689 TGTTTCCACTGTATAAAATGAGG - Intronic
1002393200 5:178932202-178932224 CCTTACAAATGTAACAAATGCGG + Exonic
1003717305 6:8661623-8661645 CCTTTCCAGTCTTAAAGATCTGG + Intergenic
1004317214 6:14599999-14600021 ACTTTCCAGTATAATAAAAGAGG + Intergenic
1004688112 6:17967657-17967679 CCTTTGGAGAGTAAAAGATGGGG - Intronic
1005472190 6:26172178-26172200 CCTTTACAGTTTAAAAACAGAGG + Intergenic
1008149520 6:47933417-47933439 TCTCTCCAGTGCACAAAATGTGG - Intronic
1009296110 6:61949868-61949890 TATTTCCAGTTTAAAACATGAGG - Intronic
1009876393 6:69511093-69511115 CCTTTGAAATGGAAAAAATGAGG - Intergenic
1011173216 6:84529786-84529808 GTTTTCCTGTGTATAAAATGAGG - Intergenic
1011792260 6:90911204-90911226 CCTTTCCAGTCTGACAGATGGGG - Intergenic
1012420654 6:99061314-99061336 CCTTTCCAGTGGAAAAATAAGGG - Intergenic
1012906437 6:105071958-105071980 CCTTGGCAGTGTAAAGAATCTGG + Intronic
1017853185 6:158324066-158324088 CCTTTCCAGGGTAAAAAACTAGG - Intronic
1018457558 6:163965467-163965489 CCTTTCCATTGAAAATAATTTGG - Intergenic
1019018093 6:168894910-168894932 ACTTACCAGTGCAAAATATGAGG + Intergenic
1019915595 7:4130147-4130169 CCTTTCCAATGCAAACAATTTGG + Intronic
1020883210 7:13790044-13790066 CCTTACCAGTTTAAAAAATAGGG + Intergenic
1021123992 7:16829239-16829261 TCTTTCCAGTGCTAAAAGTGGGG - Intronic
1021512083 7:21444451-21444473 CCTTTCAGGTATAAAAACTGAGG + Intronic
1021683811 7:23161774-23161796 CATTTGCAGAGTCAAAAATGAGG + Intronic
1022175616 7:27869398-27869420 AGTTTCCATTGTAATAAATGTGG + Intronic
1022330704 7:29376106-29376128 GCTTTCCATTGGAAAAAATGTGG + Intronic
1024260125 7:47568132-47568154 CCTTTCCTTTGAGAAAAATGGGG - Intronic
1024607513 7:51034503-51034525 ACTTTCCAGTGTAAGAAAGCAGG + Intronic
1024819260 7:53307885-53307907 CATATCCAGTGTAGAAAATGGGG + Intergenic
1025721102 7:64015315-64015337 CATTTCAAATGTAAAAAATATGG + Intergenic
1025748235 7:64266180-64266202 CATTTCAAATGTAAAAAATATGG + Exonic
1025767505 7:64469459-64469481 CCCTTCAAATGTAAAGAATGTGG + Intergenic
1025792894 7:64708291-64708313 CCTTACAAATGTAAAGAATGTGG + Exonic
1025817398 7:64927941-64927963 CCTTTCAAATGTAAAGAATGTGG + Exonic
1025822286 7:64978051-64978073 CCTTACAAGTGTGAAGAATGTGG - Exonic
1025822366 7:64979059-64979081 CCTTACAAATGTAAAGAATGTGG - Exonic
1025867484 7:65398628-65398650 CCTTTCAAATGTAAAAACCGTGG + Exonic
1027425212 7:78055119-78055141 TCTATCCAGTGTTAAACATGAGG + Intronic
1028333200 7:89622256-89622278 CCTTTCCTGTGCAAAGATTGTGG + Intergenic
1028735648 7:94209339-94209361 CCTTTCCATGGCAGAAAATGTGG + Intergenic
1029294802 7:99531623-99531645 CCCTTCAAGTGTAACGAATGTGG + Exonic
1029294850 7:99532127-99532149 CCTTTTCAATGTAAAGAATGTGG + Exonic
1029357652 7:100064354-100064376 CCTTATCAGTGTAACGAATGTGG + Exonic
1030771097 7:113475693-113475715 CCTTCACAGTGTAAACAAAGTGG - Intergenic
1031427081 7:121617887-121617909 CCTTAGCAATGTACAAAATGAGG - Intergenic
1032358997 7:131237399-131237421 CATTTCCTGTGTGAAAAATGAGG - Intronic
1033189161 7:139261026-139261048 CCATTACAGTGAAGAAAATGGGG - Intronic
1033682204 7:143605424-143605446 CATTTCCTGTGTGTAAAATGGGG + Intergenic
1033702685 7:143856489-143856511 CATTTCCTGTGTGTAAAATGGGG - Intronic
1033843928 7:145409102-145409124 CTTTTCCTTTGTAAGAAATGTGG + Intergenic
1034546753 7:151794397-151794419 ACTTTCCAGTGTGTAAAAGGAGG + Intronic
1041479985 8:58309097-58309119 CCTTTCAAGTATGAAATATGCGG + Intergenic
1044071239 8:87762769-87762791 GCTTTCTTGTCTAAAAAATGAGG + Intergenic
1044303447 8:90610951-90610973 CCTTTCTGGTTTAAAAATTGTGG + Intergenic
1047201751 8:122773066-122773088 GCTTTCTAGTTTTAAAAATGTGG - Intergenic
1047780257 8:128105341-128105363 TCTTTCCTGTTTATAAAATGGGG - Intergenic
1048189865 8:132278139-132278161 AATTTCCAGAGTACAAAATGGGG - Intronic
1048312575 8:133336945-133336967 CCTATGCATTGTAAAATATGTGG - Intergenic
1048630749 8:136239701-136239723 CTTATACAGTGTTAAAAATGAGG - Intergenic
1049858627 8:144881744-144881766 CCCTTCCAGTGCACAGAATGTGG - Exonic
1049871121 8:144977602-144977624 CCTTACAAGTGCAAAGAATGTGG - Intergenic
1049874305 8:145005810-145005832 CCTTATCAGTGTAACAAACGTGG - Intergenic
1050680891 9:8110068-8110090 CCTGTCCATTTTTAAAAATGAGG - Intergenic
1051954859 9:22679958-22679980 CCTGCACAGTGCAAAAAATGAGG - Intergenic
1052233321 9:26181535-26181557 CCATTCCATTTTAGAAAATGTGG - Intergenic
1053659472 9:40256955-40256977 CATTTGCGATGTAAAAAATGGGG + Intronic
1053702496 9:40710208-40710230 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1053702576 9:40711364-40711386 CCATACCATTGTGAAAAATGTGG + Intergenic
1053909844 9:42886320-42886342 CATTTGCGATGTAAAAAATGGGG + Intergenic
1054371601 9:64403257-64403279 CATTTGCGATGTAAAAAATGGGG + Intronic
1054412555 9:64833671-64833693 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1054412635 9:64834827-64834849 CCATACCATTGTGAAAAATGTGG + Intergenic
1054525126 9:66119262-66119284 CATTTGCGATGTAAAAAATGGGG - Intronic
1054679218 9:67892971-67892993 CATTTGCGATGTAAAAAATGGGG + Intronic
1054915492 9:70491817-70491839 CCTTTCCCATTTAAAAATTGTGG - Intergenic
1055680233 9:78706778-78706800 CCTTTCCTGGGTAAAAGATTAGG + Intergenic
1056623025 9:88230457-88230479 CCATTTCAGTGAAAAAAATGTGG + Intergenic
1057454823 9:95198687-95198709 CATTTCCAGTGTAAATACTTGGG - Intronic
1057535612 9:95901242-95901264 CCTTTCCAAGGAAAAAAATCGGG - Intronic
1057635269 9:96758929-96758951 CCCTTTCAGTGTAATAAATGTGG - Exonic
1057706993 9:97401915-97401937 CCTTTCCTGTTTCATAAATGGGG + Intergenic
1058145669 9:101408291-101408313 CCTTTTCAGTGCAATGAATGTGG + Exonic
1059263023 9:112997280-112997302 CCCTACCAGTGTAATGAATGTGG - Intergenic
1059655805 9:116356261-116356283 CTTTTCTTGTGTATAAAATGAGG + Intronic
1059948591 9:119438525-119438547 CCTGTCCAGAGTACAAAATAAGG + Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061474417 9:130854444-130854466 CCTTTTCAGTATAAAAAATAGGG - Intronic
1062368488 9:136223853-136223875 CCTTTCAAGAGGAAAAAAAGAGG + Exonic
1187586301 X:20665788-20665810 TCTCTCTACTGTAAAAAATGGGG + Intergenic
1188251896 X:27906569-27906591 CCTTTCCAATGAAAGACATGTGG + Intergenic
1188442923 X:30230874-30230896 GCTTTCCAGGGTTAAAAATATGG - Intronic
1188558932 X:31445520-31445542 TCTTTCTATTGTAAAAAATAAGG - Intronic
1189306727 X:39992363-39992385 CCATTCCAGTATCAAAAACGTGG - Intergenic
1189370377 X:40423276-40423298 TCTTTCAAGTGAACAAAATGAGG + Intergenic
1189924543 X:45938749-45938771 CCTTTTTAGTTTTAAAAATGTGG + Intergenic
1191579141 X:62740879-62740901 CCTGTCCAGTCTAAAAAAGAAGG + Intergenic
1191710540 X:64145871-64145893 CCCTATCAGTGTAAGAAATGTGG - Intergenic
1192019677 X:67373998-67374020 CCTTTCAAATGTGAAGAATGTGG + Intergenic
1192019744 X:67375006-67375028 CCCTACCAGTATGAAAAATGTGG + Intergenic
1193674290 X:84429841-84429863 CCTTTCCATTGCAAAAAAAATGG - Intronic
1193726411 X:85044678-85044700 ACCTTACAGAGTAAAAAATGTGG + Intronic
1194679038 X:96829281-96829303 CCCTTCCTCTCTAAAAAATGGGG - Intronic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195996511 X:110737087-110737109 CCTTTCCAGAGGAAATAGTGGGG - Intronic
1196528094 X:116750696-116750718 CCTTTCCTGTGTATAGATTGTGG - Intergenic
1196980333 X:121206360-121206382 TCTGTCCAGTGTTGAAAATGGGG + Intergenic
1197360501 X:125496574-125496596 CCCATCCAGTGTAAAGATTGTGG - Intergenic
1200853727 Y:7913913-7913935 ACTTGTCAGTGTAATAAATGTGG - Intergenic
1200860816 Y:7989989-7990011 ACATTCAAATGTAAAAAATGTGG + Intergenic
1201666046 Y:16456785-16456807 CCTTTTCATTGGAAATAATGGGG - Intergenic
1201988802 Y:20001490-20001512 CTTTTCCAATGTAAATAATGTGG - Intergenic
1201988812 Y:20001659-20001681 CCTTTCAAATGTAATAAGTGTGG - Intergenic