ID: 1164050062

View in Genome Browser
Species Human (GRCh38)
Location 19:21578173-21578195
Sequence CCTCCGCCTCCCAAGTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164050058_1164050062 17 Left 1164050058 19:21578133-21578155 CCAGGCTGGAGTGCAATGGCATG 0: 8690
1: 53085
2: 122694
3: 193906
4: 188906
Right 1164050062 19:21578173-21578195 CCTCCGCCTCCCAAGTTTAAGGG No data
1164050057_1164050062 18 Left 1164050057 19:21578132-21578154 CCCAGGCTGGAGTGCAATGGCAT 0: 8853
1: 60826
2: 154596
3: 212336
4: 181738
Right 1164050062 19:21578173-21578195 CCTCCGCCTCCCAAGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164050062 Original CRISPR CCTCCGCCTCCCAAGTTTAA GGG Intergenic
No off target data available for this crispr