ID: 1164052158

View in Genome Browser
Species Human (GRCh38)
Location 19:21592839-21592861
Sequence CCCAGGCACAGGGTGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 8, 3: 31, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164052158_1164052165 0 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052165 19:21592862-21592884 GACCCCAGCCCCGGCTCCAGTGG 0: 1
1: 0
2: 5
3: 45
4: 493
1164052158_1164052166 1 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052166 19:21592863-21592885 ACCCCAGCCCCGGCTCCAGTGGG 0: 1
1: 0
2: 5
3: 45
4: 353
1164052158_1164052163 -9 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052163 19:21592853-21592875 GTGCCTGGGGACCCCAGCCCCGG 0: 1
1: 0
2: 2
3: 51
4: 721
1164052158_1164052176 29 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052176 19:21592891-21592913 TCCTTCTGTTGTGGCACAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 142
1164052158_1164052175 26 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052175 19:21592888-21592910 AGTTCCTTCTGTTGTGGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1164052158_1164052174 20 Left 1164052158 19:21592839-21592861 CCACAGAACACCCTGTGCCTGGG 0: 1
1: 0
2: 8
3: 31
4: 297
Right 1164052174 19:21592882-21592904 TGGGTCAGTTCCTTCTGTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164052158 Original CRISPR CCCAGGCACAGGGTGTTCTG TGG (reversed) Intergenic
900130240 1:1084285-1084307 GCCAGTCCCAGGGTGCTCTGTGG - Intronic
900183298 1:1321838-1321860 CCCAGGCACAGTCTGTGCAGGGG - Intronic
900203719 1:1422181-1422203 CCCAAGGACAGGGTCTCCTGAGG + Intergenic
900291778 1:1926738-1926760 TCCAGGTACAGGGTGTTGTGGGG + Exonic
900362882 1:2298444-2298466 CCCATGCTCAGGATGGTCTGGGG + Intronic
900385016 1:2406563-2406585 TCCAGGCACAGGGTGCACAGGGG + Exonic
900412385 1:2518633-2518655 CGGAGGCACCGGGTGTTGTGTGG - Intronic
900538773 1:3192387-3192409 ACCAGGCTCAGGGTGTTAGGAGG + Intronic
900600056 1:3499046-3499068 CCCAGGCACCAAGTGTCCTGTGG + Intronic
900870473 1:5298578-5298600 CCCAGGCAAAGGGAGTTGAGCGG - Intergenic
901049029 1:6417064-6417086 CCAAGGCACAGGGTGCACAGTGG - Exonic
901056352 1:6450274-6450296 CCCTGGCTCAGGCTGCTCTGGGG - Intronic
901162927 1:7193705-7193727 CCCAGGCAGTGGCTTTTCTGAGG + Intronic
902180954 1:14687954-14687976 CCACGGCACAGGGTGGTCAGGGG + Intronic
902477994 1:16698211-16698233 CCCTGGCTCAGGCTGCTCTGGGG + Intergenic
902672842 1:17986856-17986878 CCCAGGCACAGGATGTCCACTGG - Intergenic
905770588 1:40635748-40635770 TCCAGGCACAGAGTGTTGAGGGG + Intronic
906191550 1:43902448-43902470 CTCTGGCACAGGCTGTTCTCTGG - Intronic
907275910 1:53316580-53316602 CCCAGGTACAGGGTGCTCCAAGG - Intronic
909534324 1:76719008-76719030 ACCAGGCACTGGTTCTTCTGTGG + Intergenic
909663907 1:78112711-78112733 CCGAGGCACAGGCTGTTGGGAGG + Intronic
910936524 1:92487065-92487087 CCCAGGCACTGGGTGTTGGCGGG + Intergenic
912978416 1:114350027-114350049 CTCAGGCACAGGGTGTCCTCGGG + Intergenic
914384292 1:147152913-147152935 CCCAGACACAGGGTGTTTGATGG - Intergenic
914802873 1:150973778-150973800 CCCAGGTTCAGGGGGTTCTGAGG - Intronic
915029270 1:152862170-152862192 CCAGGGCACTGGGAGTTCTGAGG + Intergenic
915903442 1:159862286-159862308 ATCAGGCACAGGGTCTCCTGGGG + Intronic
917267445 1:173236365-173236387 CCAAGGCACAGTGTTTTCTGGGG + Intergenic
923092718 1:230752285-230752307 GCCAGTCACAGGGGGTTCTGCGG - Intronic
1063355840 10:5397608-5397630 CCCGGGCACAGGTTGCTCAGGGG + Intronic
1063372524 10:5531185-5531207 CCCAGACACAAGGGGTCCTGTGG - Intergenic
1063490366 10:6458372-6458394 CAGAGGCCCAGGGTATTCTGAGG + Intronic
1064164001 10:12971549-12971571 CCCAGGCACAGAGGCTGCTGGGG - Intronic
1066656781 10:37704340-37704362 CCCAGACTCAGTGTGCTCTGTGG + Intergenic
1066657867 10:37712174-37712196 CCCAGGCACATGGAGGTTTGGGG - Intergenic
1067249865 10:44577047-44577069 CCCAGGGACAGGCAGCTCTGTGG + Intergenic
1067434053 10:46264923-46264945 ACCAGGCCCAGGGTTTTCTGAGG - Intergenic
1068571498 10:58634412-58634434 CCCAGGTACAGGTTTGTCTGAGG + Intronic
1069663911 10:70142568-70142590 CCCAGACAGAGGGTGCACTGGGG + Intronic
1069760452 10:70807097-70807119 GCCAGGCACAGGGTAGCCTGTGG + Intergenic
1069954069 10:72039178-72039200 CCAGGGGACAGGGTGCTCTGAGG - Intergenic
1070977533 10:80617167-80617189 CCAGGGCACACGGTGCTCTGGGG + Intronic
1071497883 10:86181029-86181051 CCCAAGCACTGTGTGTTCGGGGG - Intronic
1072809984 10:98453974-98453996 CCTATTCTCAGGGTGTTCTGTGG - Intergenic
1073267469 10:102236481-102236503 CCCAGGCCCAGGGAGTACAGAGG + Intronic
1075292636 10:121243300-121243322 CCCTAGCCCAGGCTGTTCTGAGG - Intergenic
1075556208 10:123434437-123434459 CCCTGGCCCAGGGAGTTATGAGG - Intergenic
1075923843 10:126235165-126235187 CCCAGGCACCTGCTGCTCTGTGG + Intronic
1076187043 10:128458227-128458249 CTCAGGCAGAGGGTGGGCTGTGG + Intergenic
1076217716 10:128710085-128710107 CCCGGGCCCTGGGTGGTCTGGGG - Intergenic
1076382751 10:130036514-130036536 GCCCAGCCCAGGGTGTTCTGGGG - Intergenic
1076625800 10:131821003-131821025 CCAAGACACAGGGTGGCCTGTGG + Intergenic
1077081687 11:727239-727261 CCCAGCCCCAGGGAGTTCTGTGG - Exonic
1077155178 11:1087908-1087930 CCCAGTCACTGGCTGGTCTGAGG - Intergenic
1077187501 11:1241919-1241941 CCCTGGGACAGTGGGTTCTGTGG - Exonic
1077339269 11:2018752-2018774 CCCAAGCACAGCGGGTTCTTTGG + Intergenic
1081669060 11:44933279-44933301 GCCAGGCACAGGGTGGACAGGGG + Exonic
1082162554 11:48900774-48900796 CCCACGCCCAGGGAGCTCTGGGG + Intergenic
1082174954 11:49048772-49048794 CCCACGCACAGGGTGCTCTCGGG + Intergenic
1082243277 11:49892368-49892390 CCCAGGCACAGGGAGCTCTGGGG + Intergenic
1082657774 11:55873193-55873215 CCCACGCACAGGGAGCTCTGGGG + Intergenic
1083613157 11:64014000-64014022 CCAAGACACAGGGTGATCTGTGG - Intronic
1083885256 11:65570350-65570372 CCCGGGCACAGCGAGGTCTGAGG + Intergenic
1083962979 11:66024774-66024796 CCCGAGCACAGGATGATCTGTGG + Intronic
1084170078 11:67396810-67396832 CCCAGGGACAGGCTGGGCTGGGG - Intronic
1084215504 11:67645115-67645137 CCCAGCCACAGGGTGTGCTGCGG - Exonic
1086690820 11:89787314-89787336 CCCACGCACAGGGTCCTCTCGGG - Intergenic
1086697702 11:89864191-89864213 CCCACGCACAGGGAGCTCTGGGG + Intergenic
1086708459 11:89980297-89980319 CCCACGCACAGGGAGCTCTGGGG - Intergenic
1086714980 11:90052341-90052363 CCCACGCACAGGGTCCTCTCGGG + Intergenic
1087906429 11:103703264-103703286 CCCAAGCACTTGGTGTTCTCAGG - Intergenic
1088808844 11:113375829-113375851 CCCAGGCATAGCGGGATCTGAGG - Intronic
1090116472 11:123979279-123979301 CCCTGGCTCAGGGAGTCCTGAGG + Intergenic
1202822253 11_KI270721v1_random:73934-73956 CCCAAGCACAGCGGGTTCTTTGG + Intergenic
1091668684 12:2437357-2437379 GCCAGGTAAAGGGGGTTCTGAGG + Intronic
1091725781 12:2845608-2845630 GCAGGGCACAGGGTGTTCTGGGG + Intronic
1091802747 12:3334711-3334733 CCCAAGGTCAGGGTGATCTGGGG - Intergenic
1093678248 12:21969206-21969228 CACAGGCAAAGAGTGTTCTTTGG + Intergenic
1096614599 12:52824684-52824706 CAGCTGCACAGGGTGTTCTGAGG - Intronic
1097187354 12:57202915-57202937 CCCAAACACAGTCTGTTCTGAGG + Intronic
1101123218 12:101605015-101605037 CCCAGGCCCTGGGTTTACTGAGG + Intronic
1101593882 12:106146253-106146275 CCCAGGAACCGAGTGCTCTGGGG - Intergenic
1102025678 12:109713308-109713330 CCCACTCACACGGTGTTGTGAGG + Intergenic
1102645143 12:114398884-114398906 CGCAGGCACAAAGTATTCTGGGG - Intronic
1103584009 12:121937486-121937508 CCAATGCACAGGATGTTGTGAGG + Intronic
1103969351 12:124660347-124660369 CCCATGCACAGGGTTGTGTGGGG + Intergenic
1103993859 12:124816614-124816636 CCCCGGCACACGGTGTTCCAGGG - Intronic
1104042388 12:125139050-125139072 CCCGGGCTCAGGCTGTTCTCGGG - Intronic
1104934212 12:132355901-132355923 CCCAGGCCCAGGGACTCCTGAGG + Intergenic
1105001425 12:132691737-132691759 CCCAGTCATAGGGGGTTATGTGG - Intronic
1105894574 13:24707216-24707238 CCAAGGGCCAGGGTGGTCTGGGG + Intronic
1107559643 13:41547615-41547637 CCCAAGCACAGAGTGTGCTCAGG + Intergenic
1110850488 13:80239317-80239339 CCCAGGCACAGAGTGAGATGGGG + Intergenic
1113509121 13:110837919-110837941 CCCAGGGACACAGTGTACTGTGG - Intergenic
1113555517 13:111230741-111230763 ACGAACCACAGGGTGTTCTGGGG + Intronic
1113848024 13:113403543-113403565 CTCAGCCCCAGGGTGGTCTGGGG + Intergenic
1114668235 14:24394032-24394054 CCCAGGCACAGTGTCTGCTAAGG - Intergenic
1116041391 14:39690453-39690475 ACCAGGCACAGGGAATTCGGGGG + Intergenic
1118600709 14:67469979-67470001 CCCAGGCAGAGGGGGATCTCAGG - Intronic
1119483828 14:74975674-74975696 GCCAAGCACAGGTTGTCCTGAGG - Intergenic
1120525792 14:85575537-85575559 CCCAGGCAAAGGGTAGTCAGTGG + Intronic
1121570211 14:94941512-94941534 CCCAGCCACAGGCTGGTCAGAGG - Intergenic
1122062167 14:99143365-99143387 CACAGGCACAGGGCATGCTGGGG - Intergenic
1122502218 14:102208302-102208324 GCCAGGCACAGGGTTCACTGCGG - Intronic
1122981194 14:105193069-105193091 CCCATGTACAGGGTGGGCTGGGG - Intergenic
1123030862 14:105450431-105450453 TCTAGGCCCAGGCTGTTCTGGGG + Intronic
1124252377 15:28115364-28115386 AACAGGCACAGTCTGTTCTGCGG - Intronic
1124454440 15:29827425-29827447 CCCAGGGCCAGAGTGTTCTCTGG + Intronic
1124983698 15:34584917-34584939 CTCAGGCTCAGGGTGTGCAGAGG - Intronic
1128557631 15:68642430-68642452 CCCAGCCACGGGCTGTGCTGGGG + Intronic
1129161626 15:73751241-73751263 CCCAGGGCCAGGGTGGGCTGGGG - Exonic
1129995897 15:80005987-80006009 CACAGGCACAGAGTGCTCCGAGG - Intergenic
1130144765 15:81265526-81265548 ACCTGGCACAGGGTGTTAAGTGG + Intronic
1130573091 15:85066447-85066469 CCCAGCCACTGGGGGCTCTGAGG + Intronic
1131002539 15:88950228-88950250 CCCAGCCACTGGGTATGCTGGGG + Intergenic
1131369499 15:91867805-91867827 CGGAGGCCCCGGGTGTTCTGGGG + Intronic
1132059702 15:98682039-98682061 CTCAGGCATAGGGTCTTCTAGGG + Intronic
1132325350 15:100964219-100964241 CCCAGCCCCGGGGTGATCTGCGG - Intronic
1132842988 16:1987287-1987309 CCCAGCAACAGTGTGTCCTGTGG + Exonic
1132858608 16:2058632-2058654 CCCAAGCACAGGGACCTCTGGGG + Intronic
1132897949 16:2237761-2237783 CCCAGGAACAGCATGTCCTGCGG - Exonic
1134134950 16:11671800-11671822 GCCAGGCACAGGGGCTTGTGGGG + Intronic
1135278493 16:21134042-21134064 GACAGGCACAGGGTGCCCTGGGG + Intronic
1137030187 16:35516754-35516776 CCCAGGCACAGTGTTTCTTGTGG + Intergenic
1137283009 16:46993867-46993889 CCCAGTTACAGAGTTTTCTGAGG - Intergenic
1137554873 16:49464256-49464278 CCAAGGCACAGGGAGGTCAGGGG - Intergenic
1139269260 16:65666638-65666660 CCCAGGCACCTGGTGAGCTGGGG + Intergenic
1139395807 16:66637988-66638010 CCAAGGCACGGGCTGTTCTGGGG + Intronic
1141846320 16:86611329-86611351 CCCAGGCTCAGGGTGCTGGGAGG - Intergenic
1142905694 17:3040231-3040253 CCCCGGCACATGGTGTATTGAGG + Intergenic
1143486685 17:7259149-7259171 CCCAGGCCCAGGGTGCTCTGGGG - Intronic
1143619020 17:8070633-8070655 CCTAGGCCCAGTGTGTGCTGAGG - Intergenic
1144759391 17:17698742-17698764 CCCAGGCACTGAGTTTTCTTTGG + Intronic
1145910369 17:28538759-28538781 CCCAGGCCCAGGGTGGGCTGAGG - Exonic
1145996405 17:29107243-29107265 CCCAGGCACAGTGGCTACTGGGG - Intronic
1147856381 17:43483673-43483695 CGCAGGCGCAGGCTGTTTTGCGG + Intergenic
1150007657 17:61479665-61479687 CCCAGGCACAGGCAGAACTGGGG - Intronic
1150289147 17:63971688-63971710 CCCAGCCTCAGGATGTCCTGGGG + Intronic
1151342487 17:73480977-73480999 GACAGGCACAGCCTGTTCTGTGG + Intronic
1151682195 17:75628114-75628136 CCTAGGCCCACTGTGTTCTGGGG + Intronic
1151953279 17:77367077-77367099 GCCAGGCAGAGGGTGTGATGGGG + Intronic
1152007464 17:77691582-77691604 CCCATGCAGAGGGTGGCCTGGGG + Intergenic
1153330250 18:3866459-3866481 CCCAGGTACAGGGTGGGGTGGGG + Intronic
1153583733 18:6600459-6600481 GCCACGCAAAGGGTGGTCTGTGG - Intergenic
1154309100 18:13253954-13253976 CCCAAGCACAGGGCCTTCTGCGG - Intronic
1155206692 18:23564441-23564463 CCCAGCCACATGGTTATCTGAGG - Intronic
1157574321 18:48733507-48733529 CCCAGCCACAGGATGTTCCCTGG - Intronic
1157717709 18:49900374-49900396 CCCAGGCACAGGGTGGGCACAGG - Intronic
1160735879 19:662333-662355 CCCAGGCCCAGGGTCCTCTTCGG + Intronic
1160845139 19:1162951-1162973 CCCAGGGACAGCCTGTGCTGGGG + Intronic
1161459055 19:4385678-4385700 GACAGGCACAGAGTGCTCTGGGG + Intronic
1161479541 19:4503657-4503679 CCCAGGCACCTGGGGCTCTGAGG - Exonic
1161591192 19:5129806-5129828 CCAGGGCTCACGGTGTTCTGGGG + Intronic
1162756846 19:12865877-12865899 CCCAGGCCCAGCCTGTGCTGTGG + Intronic
1162818630 19:13210093-13210115 CCCAGGCACTGGAGGCTCTGGGG + Intronic
1162992633 19:14313392-14313414 CCCAGGCCCAGGTTCTCCTGCGG + Intergenic
1163322703 19:16583916-16583938 TCCAGGCAGAGGGTGAACTGGGG + Intronic
1164052158 19:21592839-21592861 CCCAGGCACAGGGTGTTCTGTGG - Intergenic
1167050620 19:47075684-47075706 GCCAGGCACTGGGGGTGCTGAGG - Intronic
1168100769 19:54139770-54139792 CCCAGGGACAGGGTCTACAGTGG - Intronic
1168493748 19:56833357-56833379 CCCAGGGACAGCGTGGTGTGTGG + Intronic
1202712014 1_KI270714v1_random:24038-24060 CCCTGGCTCAGGCTGCTCTGGGG + Intergenic
925113283 2:1354245-1354267 CTCAGGGACTGGGTGTTCCGTGG + Intronic
925113307 2:1354351-1354373 CTCAGGGACTGGGTGTTCCGTGG + Intronic
925113329 2:1354458-1354480 CTCAGGGACTGGGTGTTCCGTGG + Intronic
926153999 2:10440741-10440763 CCGAAGCACAGGCTGCTCTGTGG + Exonic
927190842 2:20515925-20515947 ACCAGGCACGGGGGGTTCAGAGG + Intergenic
929454033 2:42054030-42054052 CCCAGGCTCAGGCAGATCTGAGG - Exonic
930496026 2:52144773-52144795 CCCAGTCACAGAATTTTCTGGGG - Intergenic
931524912 2:63142579-63142601 TCCATGCACTGTGTGTTCTGTGG + Intronic
931685613 2:64789718-64789740 CCCAGGCACAGGCTGTAGGGGGG - Intergenic
932463790 2:71899992-71900014 GCCAAGCAAAGGGTGATCTGGGG - Intergenic
934144756 2:89080995-89081017 CCCAGGCAGAGGCTGGTGTGGGG - Intergenic
934224501 2:90119556-90119578 CCCAGGCAGAGGCTGGTGTGGGG + Intergenic
934666234 2:96173018-96173040 CCCAGGCAGAGGGAGTTCAATGG + Intergenic
935516885 2:104051385-104051407 CCCAGGCACTGGTGGTTCTCGGG - Intergenic
935780024 2:106502735-106502757 TCCAGGGACAGGGTGGTCTTTGG - Intergenic
936689898 2:114874193-114874215 CCCAGTCTGGGGGTGTTCTGTGG - Intronic
937053913 2:118915021-118915043 CAAAGGCACTGGGAGTTCTGGGG - Intergenic
937342205 2:121098514-121098536 CCCAGACACAGGGTGTCATGTGG - Intergenic
939380064 2:141423667-141423689 TACAGGCACAGTGAGTTCTGGGG - Intronic
942981074 2:182082796-182082818 CCAAGTCAAAGGGTGGTCTGGGG - Intronic
944451665 2:199850570-199850592 CCCAAACACAGAGTGTTTTGGGG - Intronic
945193908 2:207219919-207219941 CCCAGGCACAGCCTGCTCTAAGG + Intergenic
945660284 2:212677624-212677646 CCAAGCCACAGGATGTCCTGTGG + Intergenic
948403253 2:237699859-237699881 ACCAGGCACAGGGCACTCTGGGG - Intronic
948604133 2:239123934-239123956 CGGAGGCTCAGGGTCTTCTGTGG - Intronic
948857119 2:240735356-240735378 TCCAGGAACAGGGTGGCCTGAGG + Intronic
1169056596 20:2627054-2627076 CCCAGGCACAGTGTTTCTTGTGG - Intronic
1169188961 20:3645174-3645196 ACCAGACACAGGGTGCTCTCTGG - Intronic
1169300113 20:4434846-4434868 CCCAGGCACTGGTTAATCTGCGG + Intergenic
1172584134 20:36070755-36070777 CCCAGGCACAGGATGGTCTGTGG - Intergenic
1172636341 20:36412410-36412432 CCCAGGCTCAGGGTTCTGTGAGG + Intronic
1172732164 20:37097080-37097102 CCCAGACACAGAATCTTCTGGGG - Intergenic
1173316399 20:41948637-41948659 CCCAGGCACATGGCACTCTGTGG - Intergenic
1173825497 20:46045300-46045322 CACAGGGACAGGGTGGTGTGGGG + Intronic
1175460518 20:59148914-59148936 CCAAGGCACAAGATGCTCTGGGG - Intergenic
1175810084 20:61853149-61853171 CCCGGGCACTGGGAGTCCTGGGG + Intronic
1175895051 20:62332466-62332488 CCCCGGCACAGGGTGCTGTGGGG + Exonic
1178411075 21:32364250-32364272 GCTAGTCACAGTGTGTTCTGGGG + Intronic
1178928281 21:36793972-36793994 CACATTCACAGGGTGCTCTGAGG - Intronic
1179010229 21:37550931-37550953 CCCATGCTCTGTGTGTTCTGGGG + Intergenic
1179173403 21:38990520-38990542 CCCAGGCAGTGACTGTTCTGAGG - Intergenic
1180296437 22:10941268-10941290 GCCAGGCAAAGGCTGTTCTCTGG - Intergenic
1180816364 22:18792114-18792136 CCCAGGCACAGGGTTTTGCACGG + Intergenic
1180963975 22:19776144-19776166 CCCAGGGACAGGCAGTGCTGTGG + Intronic
1181161679 22:20963510-20963532 GCCAGGCACAGGGGGTGCTTGGG - Intergenic
1181202553 22:21226446-21226468 CCCAGGCACAGGGTTTTGCACGG + Intronic
1181362441 22:22348408-22348430 TCCAGGAACAGGCTGCTCTGGGG + Intergenic
1181986167 22:26801047-26801069 CCCAGGGGCAGGCTGTTCTCTGG + Intergenic
1183423169 22:37723984-37724006 GCTGGGCACAGGATGTTCTGGGG - Exonic
1183423231 22:37724278-37724300 GCTGGGCACAGGATGTTCTGGGG - Exonic
1183423262 22:37724425-37724447 GCTGGGCACAGGATGTTCTGGGG - Exonic
1183423279 22:37724497-37724519 GTCGGGCACAGGATGTTCTGGGG - Exonic
1183423326 22:37724713-37724735 GTCGGGCACAGGATGTTCTGGGG - Exonic
1183423340 22:37724785-37724807 GCTGGGCACAGGATGTTCTGGGG - Exonic
1183423368 22:37724926-37724948 GCTGGGCACAGGATGTTCTGGGG - Exonic
1184353795 22:43964625-43964647 GCCGGGCGCAGGGTGCTCTGTGG - Intronic
1184534416 22:45076988-45077010 CCCAGCCACACAGTGTCCTGTGG - Intergenic
1184675675 22:46041700-46041722 CCCACCTGCAGGGTGTTCTGAGG - Intergenic
1203224362 22_KI270731v1_random:68967-68989 CCCAGGCACAGGGTTTTGCACGG - Intergenic
1203266464 22_KI270734v1_random:17825-17847 CCCAGGCACAGGGTTTTGCACGG + Intergenic
950292430 3:11796316-11796338 CCAACTCACAAGGTGTTCTGAGG - Intronic
950342867 3:12263041-12263063 GCCAGGCACAGGAGGCTCTGGGG + Intergenic
950719393 3:14871752-14871774 CCCTGGGACAGCTTGTTCTGTGG + Intronic
951091092 3:18574620-18574642 CCCATGCAAAGGGTATTCTCTGG + Intergenic
953981913 3:47417569-47417591 CCCCGGCACCGGGCGGTCTGTGG - Exonic
954042432 3:47898974-47898996 GCCATTCTCAGGGTGTTCTGTGG - Intronic
954705985 3:52480753-52480775 CCCACAAACATGGTGTTCTGGGG - Intronic
955772981 3:62405004-62405026 CCCAGGGACAGGGTGATCACTGG + Intronic
958081833 3:88755881-88755903 TCCAGGCAAAGGGATTTCTGTGG - Intergenic
959520433 3:107317739-107317761 CCCCGGCACAGGGCTTTCGGAGG - Intergenic
962902580 3:139774193-139774215 ACCATCCATAGGGTGTTCTGAGG - Intergenic
966083009 3:176028507-176028529 GCCAGTCACAGGGTGGGCTGGGG - Intergenic
968506919 4:974953-974975 CCCAGGCACAGGGGGTCTTGGGG - Intronic
968706932 4:2083349-2083371 TCCAGACACAGGGCGTTCTTAGG + Intronic
969629975 4:8330356-8330378 CCCAGGCCCCGGGGCTTCTGAGG - Intergenic
970739176 4:19213088-19213110 CCCAGGCTCAGAATTTTCTGGGG - Intergenic
972335550 4:38104585-38104607 CCAAAGCACTGTGTGTTCTGTGG - Intronic
972640527 4:40921020-40921042 CCGAGGCACAGAGGGTTCGGTGG - Intronic
973286351 4:48421129-48421151 CCCAGCTACAGGGGGTGCTGAGG - Intronic
976518963 4:86004400-86004422 CACACACACAGGGTGTTTTGTGG + Intergenic
982115447 4:152095086-152095108 CACATGCACTGTGTGTTCTGAGG - Intergenic
985111062 4:186546772-186546794 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111069 4:186546804-186546826 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111076 4:186546836-186546858 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111083 4:186546868-186546890 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111090 4:186546900-186546922 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111098 4:186546932-186546954 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111106 4:186546964-186546986 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111114 4:186546996-186547018 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111122 4:186547028-186547050 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111129 4:186547060-186547082 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111150 4:186547150-186547172 CCCAGGAACAGGGTGTGAGGAGG - Intronic
985111158 4:186547182-186547204 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111165 4:186547214-186547236 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111172 4:186547246-186547268 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111186 4:186547310-186547332 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111199 4:186547374-186547396 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111210 4:186547435-186547457 CCCAGGAACAGGGTGTGAGGAGG - Intronic
985441440 4:189984638-189984660 CCCAGGGACAGGGCGGCCTGGGG - Intergenic
985513527 5:325261-325283 CCTGGGCTCAGGGTCTTCTGGGG + Intronic
985551567 5:535778-535800 CCCAGGCACAGGCTGTCCTGGGG + Intergenic
985608311 5:871181-871203 CCCAAGCACAGTGGGCTCTGGGG - Intronic
985661441 5:1159044-1159066 CCCAGGGACAGGGTGGGCAGAGG - Intergenic
985833708 5:2255067-2255089 CTCAGGCACAGTGTGGTGTGGGG + Intergenic
985968127 5:3353144-3353166 CACAGTCACAGGGTCTTGTGGGG + Intergenic
986249183 5:6040786-6040808 CCCAGGGACAGTGTTTTTTGAGG - Intergenic
986624425 5:9710103-9710125 CCAAGGCCTTGGGTGTTCTGTGG - Intronic
987134662 5:14889666-14889688 CCCAGGGACAGGACATTCTGAGG - Intergenic
987362982 5:17123307-17123329 TCCAAGGACAGTGTGTTCTGTGG + Intronic
989800071 5:45526557-45526579 CCCAGCCAAAGAGTGTTCTGAGG + Intronic
994140768 5:96338751-96338773 CCCAGGAACAGGATGTTCTGCGG - Intergenic
997917976 5:137948141-137948163 CCTAGGCACAGGCTTTACTGGGG + Intronic
998467708 5:142358758-142358780 CACAGACACAGGGGATTCTGTGG - Intergenic
998562365 5:143183544-143183566 CCCCGGCACAGGATGGACTGTGG - Intronic
998859265 5:146426747-146426769 CCCAGGTTCAGGGTGTACTCTGG + Intergenic
999285542 5:150392207-150392229 GCCAGGAAGAGGGTGTTGTGTGG + Intronic
1001700832 5:173705513-173705535 CCCAGCCACGGGGGGCTCTGGGG + Intergenic
1002067445 5:176659096-176659118 CCACCGCACAGGGTGTTGTGTGG - Intergenic
1002929075 6:1620885-1620907 CCCAGACCCCGGGTGTTCTCAGG + Intergenic
1003076132 6:2985190-2985212 CCCTGGCACAGGGGGTGCTCTGG + Intergenic
1006163220 6:32049875-32049897 CCCAGCCACAAGCAGTTCTGTGG + Intronic
1010433878 6:75808725-75808747 CTCAGCCACAGGAGGTTCTGAGG + Intronic
1013463761 6:110399811-110399833 AGAAGGCACAGGGTGTGCTGCGG - Intronic
1015813686 6:137186198-137186220 CCCAGCCCCAGGGTGATCTCAGG - Intergenic
1016109558 6:140205930-140205952 CACAGGCACAGGATGTTCAGAGG + Intergenic
1017584345 6:155903948-155903970 TCCAGGGACAGAGTGATCTGGGG + Intergenic
1019532985 7:1512898-1512920 CCCCAGCCCAGGCTGTTCTGTGG + Intergenic
1019591820 7:1839445-1839467 CCCAGGCCCAGCTTGTCCTGCGG - Intronic
1023939916 7:44762804-44762826 GCCAGGTAAAGGGTGTGCTGGGG - Intronic
1023969367 7:44979669-44979691 CCCATGCAGAGGATGCTCTGGGG - Intergenic
1026143077 7:67722694-67722716 CCCAGGCACAGCCTTTTCTCAGG + Intergenic
1026899551 7:74029351-74029373 CCCAGGCACAGTTGGTTATGGGG + Intronic
1027173363 7:75888268-75888290 CCCTGGCACGGTGTATTCTGGGG + Exonic
1027882691 7:83861514-83861536 CCCAGGTGCAGGGTGTCTTGGGG + Intergenic
1031920036 7:127593708-127593730 CCCAGGCAGAGGCTGGCCTGGGG - Exonic
1033639737 7:143250261-143250283 CCCAGGTACAGGGAGCTCAGAGG + Intronic
1034860699 7:154592438-154592460 CGCAGGCACAGGGAATACTGTGG + Intronic
1034999009 7:155596479-155596501 TCCAGGTACAGGTTGCTCTGGGG - Intergenic
1035490930 7:159277657-159277679 CCCAGACACCGGGTGGTCTGTGG + Intergenic
1035599532 8:889446-889468 CTCAGGCCTAGGGAGTTCTGGGG + Intergenic
1037725324 8:21478593-21478615 CCTGGGCACAGGGGGGTCTGGGG - Intergenic
1037804733 8:22052948-22052970 CCCAGGCATCGTGAGTTCTGGGG + Intronic
1039806804 8:41006882-41006904 CTGAGACACAGGATGTTCTGTGG - Intergenic
1045876454 8:106986608-106986630 CCCTGGCTCAGGGTGTAGTGAGG + Intergenic
1047734095 8:127750677-127750699 CCCAGGCACAGGGTGATGGTAGG - Intergenic
1048387053 8:133921721-133921743 CCCAGGCACAGGGTGTTGGGAGG + Intergenic
1048857893 8:138699669-138699691 CCCATTCTCAGGCTGTTCTGGGG - Intronic
1049368208 8:142251055-142251077 GCCAGGCAGAGGGTTTGCTGGGG + Intronic
1050191215 9:3028667-3028689 CCTTGGCTCAGGTTGTTCTGAGG - Intergenic
1052048715 9:23822555-23822577 GACAGGCACAGGTTTTTCTGGGG - Intronic
1052850255 9:33373841-33373863 CCCAGGGACAGAGTGAGCTGAGG - Intergenic
1054336607 9:63814650-63814672 ACCAGGCCCAGGGTGTGGTGCGG + Intergenic
1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG + Intronic
1056720583 9:89068199-89068221 GCCAGGCACAGGGGGTCTTGGGG - Intronic
1056834969 9:89947219-89947241 CCCAGGCACAGGTTGTAAGGAGG + Intergenic
1057945053 9:99319239-99319261 TCCATGCACATTGTGTTCTGAGG - Intergenic
1058077811 9:100668273-100668295 CCCAGGCACAGAGTGGTAAGGGG - Intergenic
1058642447 9:107100605-107100627 CCCAGGAACAGGGTTGTGTGAGG - Intergenic
1061016518 9:127983878-127983900 CCCAGGTACAGGAAGCTCTGGGG + Intergenic
1061588354 9:131582955-131582977 CCCAGGCACAATGAGTACTGTGG - Intronic
1061899632 9:133666267-133666289 CCCAGGCAAAGGGTGGGCTGTGG + Intronic
1061913629 9:133737991-133738013 CCCAGGCTCAGGGGGTGGTGGGG + Intronic
1062269820 9:135703267-135703289 CCCAGTCTCAGGCTGTCCTGAGG + Intronic
1062558548 9:137128753-137128775 CTCAGCAACAGGGTGTTCGGAGG + Intergenic
1062651036 9:137577848-137577870 CCCAGGCAAACTGGGTTCTGTGG - Intronic
1185909118 X:3965979-3966001 ACCAGGCCCAGGGTGTGGTGCGG - Intergenic
1188057742 X:25561282-25561304 CCCTGGCACATTTTGTTCTGGGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1191851358 X:65588440-65588462 CCCAGGGCCAGGGTGTGCTCAGG - Intronic
1195302448 X:103543957-103543979 AACAGGCACACCGTGTTCTGTGG - Intergenic
1200099939 X:153685350-153685372 GCCAGTGACAGGGTCTTCTGAGG - Intronic
1200181988 X:154156216-154156238 CCCAGGCATAGGGAGTTGTGGGG - Intronic
1200187637 X:154193330-154193352 CCCAGGCATAGGGAGTTGTGGGG - Intergenic
1200193286 X:154230470-154230492 CCCAGGCATAGGGAGTTGTGGGG - Intronic
1200199041 X:154268274-154268296 CCCAGGCATAGGGAGTTGTGGGG - Intronic