ID: 1164055420

View in Genome Browser
Species Human (GRCh38)
Location 19:21618081-21618103
Sequence CTCTGGAAGGAGAAGACGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164055420_1164055425 -6 Left 1164055420 19:21618081-21618103 CCCTTCGTCTTCTCCTTCCAGAG No data
Right 1164055425 19:21618098-21618120 CCAGAGGACACCCTGACATATGG No data
1164055420_1164055429 11 Left 1164055420 19:21618081-21618103 CCCTTCGTCTTCTCCTTCCAGAG No data
Right 1164055429 19:21618115-21618137 ATATGGGAATGTAGCTTCTCAGG No data
1164055420_1164055426 -5 Left 1164055420 19:21618081-21618103 CCCTTCGTCTTCTCCTTCCAGAG No data
Right 1164055426 19:21618099-21618121 CAGAGGACACCCTGACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164055420 Original CRISPR CTCTGGAAGGAGAAGACGAA GGG (reversed) Intergenic
No off target data available for this crispr