ID: 1164061937

View in Genome Browser
Species Human (GRCh38)
Location 19:21683210-21683232
Sequence TACACCTTCCTCCTTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164061937_1164061942 30 Left 1164061937 19:21683210-21683232 CCTCCATTAAGGAGGAAGGTGTA No data
Right 1164061942 19:21683263-21683285 TTCTCCAGAGATCCTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164061937 Original CRISPR TACACCTTCCTCCTTAATGG AGG (reversed) Intergenic
No off target data available for this crispr