ID: 1164063541

View in Genome Browser
Species Human (GRCh38)
Location 19:21695167-21695189
Sequence CTCTCTCAGCAGGAGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164063535_1164063541 -6 Left 1164063535 19:21695150-21695172 CCTGGAGGGATTTGGGCCTCTCT No data
Right 1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164063541 Original CRISPR CTCTCTCAGCAGGAGGAGAG GGG Intergenic
No off target data available for this crispr