ID: 1164067141

View in Genome Browser
Species Human (GRCh38)
Location 19:21725979-21726001
Sequence CTGTGCGAATGTAATAAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164067141 Original CRISPR CTGTGCGAATGTAATAAAGT TGG (reversed) Exonic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
907081691 1:51629460-51629482 TTGTGTGGATGTCATAAAGTGGG + Intronic
909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG + Intronic
909761892 1:79299055-79299077 CTGTGGGAATGTAAGATAGATGG - Intergenic
910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG + Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
919220814 1:194625972-194625994 CAGAGAGAATGGAATAAAGTTGG + Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
1071025680 10:81110136-81110158 ATGTGGGAATCTAATAAATTGGG - Intergenic
1072191390 10:93079452-93079474 CTCTGCGAATGTAGTGCAGTCGG + Intergenic
1077389064 11:2291043-2291065 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389086 11:2291150-2291172 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389097 11:2291206-2291228 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389324 11:2292338-2292360 CTCTGCGAATATACTAAAGCGGG - Intergenic
1082759752 11:57115921-57115943 CTGCTAGAAAGTAATAAAGTCGG + Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG + Intronic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1101687197 12:107036750-107036772 CTGTGCAAAGGTACTGAAGTAGG - Intronic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1105754309 13:23451117-23451139 GTGTGCAAATGTGATAAAGGAGG - Intergenic
1110011932 13:70347060-70347082 ATGTGGGAAGGTAAAAAAGTTGG + Intergenic
1115389736 14:32841615-32841637 CTGTGAGAATGGACTAAAATTGG - Intergenic
1117787781 14:59305009-59305031 CTTTCAGAATGTCATAAAGTAGG - Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1127574833 15:60281199-60281221 CTGTGGAATTGTAATAAAATGGG - Intergenic
1128915576 15:71558381-71558403 CTGTTCTAATGTATTAAAGATGG + Intronic
1130510001 15:84581636-84581658 CTGTGCAATTTTAATAGAGTGGG + Intergenic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1140358025 16:74322389-74322411 GTATGCGAATGTAATACAATTGG - Intergenic
1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG + Intronic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1151020128 17:70605548-70605570 ATGTGAGACAGTAATAAAGTGGG - Intergenic
1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG + Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155607003 18:27617805-27617827 CTGAGTCAATGTCATAAAGTAGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
933436397 2:82255884-82255906 CAGGGAGAATGGAATAAAGTTGG - Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG + Intronic
937017412 2:118618725-118618747 CTGTGCAAAGGTAAGAAAGGAGG - Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
942977382 2:182034693-182034715 ATGTGCGAATGTCAATAAGTGGG + Intronic
942989339 2:182180683-182180705 CTGGGAGAATGGAATCAAGTTGG - Intronic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
943791848 2:191942068-191942090 CTGTGTGACTGTAATTAAGCAGG + Intergenic
943894785 2:193342481-193342503 CTGTGCAAATGCAATCAACTGGG - Intergenic
945809854 2:214535515-214535537 CTGTTTGAATGTAATAAACCTGG - Intronic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
948790882 2:240376284-240376306 CTCTGCCCATGTAATAAAGATGG - Intergenic
1170385078 20:15807424-15807446 GTGTGTGTATGTACTAAAGTAGG - Intronic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
950204616 3:11069319-11069341 ATGTTTAAATGTAATAAAGTAGG + Intergenic
960278328 3:115752419-115752441 CTGGGAGAATGGAATCAAGTTGG + Intergenic
964489451 3:157219736-157219758 GTGTGTGTATGAAATAAAGTAGG - Intergenic
964591902 3:158374070-158374092 CTATGTGCATATAATAAAGTTGG - Intronic
964883344 3:161449336-161449358 CTGTGCTACTGTAATAATTTTGG + Intergenic
965280585 3:166747312-166747334 ATGTGCGAATATAATAAGATGGG - Intergenic
970775574 4:19670092-19670114 CTGGGAGAATGGAATCAAGTTGG + Intergenic
977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG + Intronic
978051963 4:104212154-104212176 CTGTGGGTATGTAGTATAGTGGG - Intergenic
979017332 4:115451285-115451307 CAGGGAGAATGTAATCAAGTTGG - Intergenic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
982253449 4:153430459-153430481 CTTTGTGAATGGTATAAAGTAGG - Intergenic
983862857 4:172729675-172729697 CTGTGCAAAATTAACAAAGTTGG - Intronic
985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG + Intronic
988234952 5:28530264-28530286 CTGACCTTATGTAATAAAGTAGG - Intergenic
988330283 5:29828847-29828869 CTGTGGCAATTTCATAAAGTAGG + Intergenic
990315153 5:54576642-54576664 CACTGCTACTGTAATAAAGTGGG - Intergenic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
994128028 5:96191574-96191596 CTGTGAGGATATAATAAAGATGG + Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009905973 6:69869892-69869914 CTGAGGAAATGTAATAGAGTTGG + Intronic
1010041185 6:71386442-71386464 TTGTGCAAATGTAATCATGTGGG - Intergenic
1011028071 6:82891275-82891297 CTGTGCTAATGGAATCTAGTGGG + Intergenic
1014127785 6:117796263-117796285 CTATGCAAATCTAGTAAAGTTGG + Intergenic
1016725331 6:147358696-147358718 CTGTATTCATGTAATAAAGTAGG + Intronic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1024630432 7:51242843-51242865 CTGTGCGGAGGTGATAATGTTGG - Intronic
1027729097 7:81846854-81846876 TTGTGCAAATGTAATAACGCAGG - Intergenic
1029818287 7:103119827-103119849 CTGTGAGAATGTGATTGAGTTGG - Exonic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1052178554 9:25496333-25496355 CTGTGCAACTGGAATAAAATTGG - Intergenic
1055850259 9:80619351-80619373 CTGCTCCTATGTAATAAAGTAGG - Intergenic
1188020864 X:25155952-25155974 CTGTGAGAATATAATAGACTAGG - Intergenic
1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG + Intergenic
1191147948 X:57188983-57189005 CTGGGAGAATGGAATCAAGTTGG - Intergenic
1191170575 X:57443209-57443231 CGGTGAGAATGGAATCAAGTTGG - Intronic
1191984985 X:66970002-66970024 CGGTGAGAATGGAACAAAGTTGG + Intergenic
1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG + Intronic
1193620977 X:83752027-83752049 CTGGGAGAATGGAACAAAGTTGG + Intergenic
1196566796 X:117216353-117216375 CTGAGCAAAAATAATAAAGTTGG + Intergenic
1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG + Intergenic