ID: 1164070372

View in Genome Browser
Species Human (GRCh38)
Location 19:21762768-21762790
Sequence GAATAGGGCCTGGGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 8, 3: 47, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164070366_1164070372 -5 Left 1164070366 19:21762750-21762772 CCAAAGCAAATCCATTTTGAATA 0: 1
1: 0
2: 67
3: 673
4: 1206
Right 1164070372 19:21762768-21762790 GAATAGGGCCTGGGTAAAACAGG 0: 1
1: 1
2: 8
3: 47
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164070372 Original CRISPR GAATAGGGCCTGGGTAAAAC AGG Intronic
901797466 1:11688719-11688741 GAGTAGGGGCTGGGTCAAATGGG + Intronic
902261196 1:15226199-15226221 GAAAAGGGCCTGTGTTAAACTGG - Intergenic
906945399 1:50290281-50290303 GAATCTTCCCTGGGTAAAACTGG + Intergenic
907569236 1:55467706-55467728 GAATGGGGCCTGGGGAGAATGGG + Intergenic
912388780 1:109287076-109287098 GAATAGGGGCTGGTTAAATAAGG - Intergenic
913382820 1:118229403-118229425 GTATAGGGGTTGGGTACAACTGG - Intergenic
913469736 1:119176166-119176188 GTATAGGGGTTGGGTACAACTGG - Intergenic
913969509 1:143403932-143403954 GGAAAGAGCCTGGGTAAGACAGG + Intergenic
914063886 1:144229531-144229553 GGAAAGAGCCTGGGTAAGACAGG + Intergenic
914115264 1:144736823-144736845 GGAAAGAGCCTGGGTAAGACAGG - Intergenic
914442099 1:147716756-147716778 GAATAGGCCCTGGATAAAATAGG - Intergenic
915260781 1:154675356-154675378 GTATAGGGGTTGGGTACAACTGG - Intergenic
915275368 1:154784569-154784591 GCACAGGGCCTGGGGAATACTGG - Intronic
916083877 1:161254239-161254261 GTATAGGGGTTGGGTACAACTGG - Intergenic
916288897 1:163141805-163141827 GGATTGGGACTGGGTAAAAGGGG - Intronic
916493778 1:165326690-165326712 GAAGAGGGCCTAGGAAGAACTGG - Intronic
916814066 1:168333698-168333720 GAATAGGAGCTGGGTAAAATGGG - Intergenic
916939739 1:169665876-169665898 GTATAGGGGTTGGGTACAACTGG - Intronic
917482294 1:175422798-175422820 AAATAGGGCCTGTGTAATCCAGG - Intronic
918187179 1:182138265-182138287 GATCAGAGCCTGGGTAGAACTGG - Intergenic
919558913 1:199094391-199094413 GTATAGGGGTTGGGTACAACTGG - Intergenic
919966535 1:202532418-202532440 GAATACGGGCTGGGTAAATAAGG - Intronic
921019907 1:211226054-211226076 GTATAGGGGTTGGGTACAACTGG - Intergenic
922190378 1:223313585-223313607 GAATAGGGGCTGAGTAAATAAGG + Intronic
923151977 1:231241506-231241528 GAATAGGGACTGGGAGAAAGGGG - Intronic
923655492 1:235912349-235912371 GTGTAGGGCCTGGGGAAATCAGG + Intergenic
1062827249 10:581738-581760 CAGTAGGGCCTGGGCAGAACCGG - Intronic
1063321493 10:5056372-5056394 GTATAGGGATTGGGTACAACTGG + Intronic
1064610298 10:17092393-17092415 GAATAGGGGCTGGATAAAATAGG + Intronic
1066614367 10:37280785-37280807 GTATAGGGGTTGGGTACAACTGG + Intronic
1067037983 10:42933371-42933393 GAATAGGGTCTCGGGAAAAAGGG + Intergenic
1068098338 10:52520427-52520449 GAATAGGGGCTGGGTAAAATAGG + Intergenic
1068495943 10:57785743-57785765 GAATAGGGGCTGGGTAATATGGG + Intergenic
1069273281 10:66558099-66558121 GAATAAGCACTGGGGAAAACTGG + Intronic
1073808469 10:107126080-107126102 GAAAAGGGCCAAGGTCAAACAGG - Intronic
1073970967 10:109045130-109045152 GTATAGGGGTTGGGTACAACTGG - Intergenic
1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG + Intergenic
1076179876 10:128398895-128398917 GAATTGGGCCAGGGTAAGCCAGG + Intergenic
1076315276 10:129535449-129535471 GAATAGAGCCTGGGGAATACAGG - Intronic
1079731001 11:23937722-23937744 GTATAGGGGTTGGGTACAACTGG + Intergenic
1080352777 11:31404271-31404293 GAATAGGAGCTGGGTAAAATGGG - Intronic
1080887235 11:36377629-36377651 GGACAGGGACTGGGTAGAACTGG - Intronic
1081273315 11:41114973-41114995 GATGAGGGCCGGGATAAAACAGG + Intronic
1082191507 11:49250996-49251018 GAATAGGGGATGGGTAAAATAGG - Intergenic
1082852844 11:57780813-57780835 GAATTGGGACTGTGTAAATCTGG + Intronic
1083025617 11:59548245-59548267 GAATAGGGGCTGGGTAAAATAGG - Intergenic
1084211231 11:67623876-67623898 GTATAGGGTTTGGGTACAACTGG - Intergenic
1086179227 11:83930415-83930437 GAATAGTGCCTGGGAGAAGCAGG + Exonic
1086317609 11:85610350-85610372 GTATAGGGGTTGGGTACAACTGG - Intronic
1086674618 11:89590022-89590044 GAATAGGGGATGGGTAAAATAGG + Intergenic
1087075202 11:94122038-94122060 GTATAGGGGTTGGGTACAACTGG - Intergenic
1087683123 11:101236810-101236832 GTATAGGGGTTGGGTACAACTGG + Intergenic
1088492758 11:110403240-110403262 GTATAGGGGTTGGGTACAACTGG - Intergenic
1088641866 11:111880328-111880350 GAATAGGGGCTAGGTAAATAAGG + Intronic
1089306931 11:117532348-117532370 GGAGAGGGCCTGGGGAGAACGGG - Intronic
1091573681 12:1713266-1713288 GTATAGGGCTTGGGTACAACTGG + Intronic
1092292470 12:7170212-7170234 CAATAGGGCCAGGGCAAAAGAGG + Intergenic
1092460225 12:8679855-8679877 GAATAGGAGCTGGGTAAATGAGG + Intergenic
1092472534 12:8792126-8792148 GTATAGGGGTTGGGTACAACTGG - Intergenic
1093170480 12:15854091-15854113 GAATAGGGGCTAGGTAAAATAGG - Intronic
1095879265 12:47115026-47115048 CAGTAGGGTCTGAGTAAAACAGG + Intronic
1095965031 12:47861392-47861414 GGATTGGGCCTGTGTGAAACTGG - Intronic
1098392552 12:69984897-69984919 GAAGTGGGCCTGGCTGAAACTGG + Intergenic
1099428850 12:82556483-82556505 GTATAGGGACTGTGGAAAACTGG + Intergenic
1102059477 12:109922086-109922108 GAATAGAGCCTGGGTGGCACAGG - Intronic
1102890693 12:116556523-116556545 GAATAGGAGCTGGGTAAAAAGGG - Intergenic
1103621630 12:122190473-122190495 GAATAGGGTCTGGGTCAAATGGG - Intronic
1104748885 12:131226122-131226144 GAAGATGGGCTGTGTAAAACCGG - Intergenic
1104784238 12:131439442-131439464 GAAGATGGGCTGTGTAAAACCGG + Intergenic
1105762708 13:23528693-23528715 GTATAGGGGTTGGGTACAACTGG - Intergenic
1106041269 13:26096147-26096169 GAATAGGGGCTGGGAAAATAGGG + Intergenic
1106162925 13:27216571-27216593 GTATAGGGGTTGGGTACAACTGG - Intergenic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1108391504 13:49952067-49952089 GAATAGGGGCTGGGTAAATGAGG - Intergenic
1108848824 13:54704096-54704118 GTATAGGGGTTGGGTAAAACTGG - Intergenic
1110997420 13:82130010-82130032 GTATAAGGCCTGGTTGAAACAGG + Intergenic
1111372743 13:87337345-87337367 GTATAGGGGTTGGGTACAACTGG - Intergenic
1112519351 13:100082128-100082150 GTATAGGGGTTGGGTACAACTGG - Intergenic
1112538603 13:100284647-100284669 GTATAGGGGTTGGGTACAACTGG - Intronic
1112931171 13:104740056-104740078 GAATAGCACTTGTGTAAAACTGG - Intergenic
1113168057 13:107465881-107465903 GAATAGTGCCTTATTAAAACAGG - Intronic
1113551277 13:111194929-111194951 GTATAGGGGTTGGGTACAACTGG + Intronic
1113611933 13:111652910-111652932 TGATATGGCCTGGGTAGAACTGG + Intronic
1114489353 14:23088402-23088424 AAACAGGGACTGAGTAAAACAGG + Intronic
1115065475 14:29254716-29254738 GAATAGTGCCTGTATAAAATAGG + Intergenic
1116935322 14:50733601-50733623 TAATGGGTGCTGGGTAAAACAGG + Intronic
1124720793 15:32109475-32109497 AAATAGGAGCTGGGTAAAGCAGG - Intronic
1124795299 15:32772374-32772396 TTATATGGCATGGGTAAAACTGG + Exonic
1125629958 15:41139210-41139232 GAATAGGGCCTGGATAAATAAGG + Intergenic
1128118930 15:65131797-65131819 AAGCAGGGCCAGGGTAAAACTGG - Intronic
1133808963 16:9146580-9146602 GATCCGGGCCTGGTTAAAACTGG + Intergenic
1135339449 16:21633622-21633644 GTATAGGGGTTGGGTACAACTGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136221604 16:28833012-28833034 GACTAGGGTCTGGGTCAGACTGG + Intronic
1137027339 16:35490183-35490205 GACTAGGCCTTGGGTAAAAAGGG + Intergenic
1138048781 16:53754081-53754103 AAATAGGGCCTAGCTAAAAGAGG - Intronic
1138193345 16:55034147-55034169 GAACAGGGCTCGGGAAAAACTGG + Intergenic
1145288975 17:21528209-21528231 GAATAGGGGCTGGGTAAATAAGG - Intronic
1149008635 17:51832034-51832056 GAAGTTGGCCTGGGGAAAACAGG - Intronic
1151568241 17:74912209-74912231 GTATAGGGGTTGGGTACAACTGG - Intergenic
1151865254 17:76797689-76797711 AAATAGGGGCTGGGTAAAATGGG - Intergenic
1151935694 17:77259541-77259563 GAATACGGCCTGGGAAAATATGG + Intergenic
1153310493 18:3673093-3673115 GAATAGGGCCTGGGGAACCACGG - Intronic
1155475902 18:26235796-26235818 GTATAGGGGTTGGGTACAACTGG + Intronic
1161598005 19:5162081-5162103 GTATAGGGGTTGGGTACAACTGG + Intronic
1163999766 19:21086733-21086755 GAATAGGGGCTGGATAAAATAGG - Intronic
1164005717 19:21146820-21146842 GAATAGGGGCTGGGTAAAATAGG - Intronic
1164027420 19:21365365-21365387 GAATAGGGGGTGGGTAAAATAGG - Intronic
1164070372 19:21762768-21762790 GAATAGGGCCTGGGTAAAACAGG + Intronic
1164508797 19:28880951-28880973 GAATAGGGGCTGGATAAAAATGG + Intergenic
1165701263 19:37939971-37939993 GAATAGTGCCTGTACAAAACAGG - Intronic
1168678078 19:58293510-58293532 GAAGAGGGCTTGGGGAAAGCGGG + Intronic
928247276 2:29641460-29641482 GAACAGCCCCTGGGAAAAACAGG + Intronic
928409278 2:31041933-31041955 GTTTCAGGCCTGGGTAAAACAGG + Intronic
928617404 2:33054137-33054159 GTATAGGGGTTGGGTACAACTGG + Intronic
930242147 2:48947046-48947068 GAAAAGGTCTTGGGGAAAACTGG - Intergenic
930686902 2:54319143-54319165 GAATAGGGGGTGATTAAAACAGG + Intergenic
934174200 2:89564847-89564869 GGAAAGAGCCTGGGTAAGACAGG + Intergenic
934284516 2:91639196-91639218 GGAAAGAGCCTGGGTAAGACAGG + Intergenic
934867342 2:97824948-97824970 GTATAGGGGTTGGGTACAACTGG - Intronic
935115010 2:100127830-100127852 GAATAGGAGCTGGGTAAATGAGG + Intronic
935783735 2:106530648-106530670 GAATAGGGGCTAGGTAAGATGGG + Intergenic
936512456 2:113159093-113159115 GAATAGTGCCTGGGACATACAGG - Intronic
940184889 2:150972817-150972839 GAATAGGAGCTGGGTAAAATGGG - Intergenic
940852431 2:158701395-158701417 GAAGACAGCCTGGTTAAAACAGG - Intergenic
942403451 2:175628079-175628101 GAATAGGTAATGGGTAGAACAGG - Intergenic
942505468 2:176637695-176637717 GATCGGGGCCTGGGAAAAACGGG + Intergenic
943133965 2:183889287-183889309 GTATAGGGGTTGGGTACAACTGG - Intergenic
944016381 2:195044459-195044481 GAAAAGGGACTGGATAAAATGGG - Intergenic
944729216 2:202500759-202500781 GTATAGGGGTTGGGTACAACTGG - Intronic
946207156 2:218118090-218118112 GTATAGGGGTTGGGTATAACTGG + Intergenic
946845400 2:223854408-223854430 GAATAGGGGCTGGGAAAATAAGG + Intergenic
948334640 2:237198179-237198201 GAAAAGGGTATGGGTCAAACAGG - Intergenic
1168859731 20:1037295-1037317 ACATAGGGCCTGAGTAAAACTGG - Intergenic
1169441174 20:5635118-5635140 GAATATGAGCTGGGTAAAAAAGG + Intergenic
1171468194 20:25347624-25347646 GAAACTGGCCTGGGCAAAACAGG + Intronic
1175059427 20:56228307-56228329 GAATAGGAGCTGGGTAAAATGGG + Intergenic
1175408103 20:58748123-58748145 GAAGAGGGCCTGGGTAGATTAGG + Intergenic
1183326201 22:37196051-37196073 GAGTAGGAGCTGGGTAAAATAGG - Intronic
951020696 3:17778290-17778312 GTATAGGGGTTGGGTACAACTGG - Intronic
951446996 3:22794323-22794345 AAATAGGACCTGGTGAAAACAGG - Intergenic
952854562 3:37758380-37758402 TAATATAGTCTGGGTAAAACAGG + Intronic
953495068 3:43378764-43378786 CTATAGAGCCTGGGTAAAGCTGG + Intronic
954587192 3:51746175-51746197 GTATAGGGATTGGGTACAACCGG - Intergenic
954919298 3:54175765-54175787 GAATAGGGGCTTGGCAAAACAGG + Intronic
958549026 3:95591636-95591658 GTATAGGGGTTGGGTACAACTGG + Intergenic
960509505 3:118531360-118531382 GTATAGAGGCTGGGTAAAATAGG - Intergenic
960884764 3:122383115-122383137 GAATAGGGTCTGGGGACAAAAGG + Intronic
963024171 3:140901609-140901631 GAAAAGGGCCTGGGTACATAAGG + Intergenic
963406013 3:144864918-144864940 CAATAGTGCCTGTATAAAACTGG + Intergenic
964064709 3:152563675-152563697 GTATAGGGGTTGGGTACAACTGG - Intergenic
965139400 3:164815336-164815358 GTATAGGGGTTGGGTACAACTGG - Intergenic
971578666 4:28306871-28306893 GTATAGGGGTTGGGTATAACTGG - Intergenic
972053759 4:34774110-34774132 GAATAGGGACTGGGAAAACAAGG + Intergenic
972781855 4:42293107-42293129 GAATAGGAGCTGGGTAAAATGGG + Intergenic
974072439 4:57136548-57136570 GAATAGGGGCTGGATAAAAAAGG - Intergenic
974174704 4:58308206-58308228 GTATAGGGGTTGGGTACAACTGG - Intergenic
974187522 4:58461942-58461964 GTATAGGGTTTGGGTACAACTGG - Intergenic
974838654 4:67278450-67278472 GTATAGGGGTTGGGTACAACTGG + Intergenic
975415083 4:74096667-74096689 GAATAGGGGCTAGGCAAAATGGG - Intergenic
975595625 4:76046331-76046353 GTATAGGGGTTGGGTACAACTGG + Intronic
976913552 4:90340135-90340157 GAATAGGACCTTGCTAAAACAGG + Intronic
976984359 4:91274488-91274510 TACTAGGGCCTGGGAAAAATGGG - Intronic
977147767 4:93466689-93466711 GATTAGGCACTGGCTAAAACAGG - Intronic
977884281 4:102239154-102239176 GTATAGGGGTTGGGTACAACTGG - Intergenic
979362000 4:119775750-119775772 GAATAGGGGCTGGGTAAAACAGG - Intergenic
979614832 4:122731255-122731277 GAATAGTGCCTGGCAAAAATAGG + Intergenic
980226683 4:129996599-129996621 GATTAGGGCCTGGATAATATGGG - Intergenic
981699945 4:147597358-147597380 GGAAAGGGCCTGGCTAAAACTGG + Intergenic
982003056 4:151038647-151038669 GAATAGGGGCTGGGTAAATGAGG + Intergenic
982701323 4:158661836-158661858 GTATAGGGGTTGGGTACAACTGG - Intergenic
983834744 4:172373336-172373358 GAATAGGGGTTGGGTACAACTGG + Intronic
983878087 4:172900086-172900108 GAATAGAGGCTGGGTAAATAAGG - Intronic
984917648 4:184738292-184738314 GTATAGGGGTTGGGTACAACTGG - Intergenic
986913755 5:12589961-12589983 GGATATGGCCTGGAGAAAACAGG - Intergenic
987545049 5:19303490-19303512 GTATAGGGGTTGGGTACAACTGG + Intergenic
987818065 5:22929968-22929990 GTATAGGGGTTGGGTACAACTGG - Intergenic
988591813 5:32556006-32556028 GTATAGGGGTTGGGTACAACTGG + Intronic
989496369 5:42114715-42114737 GTATAGGGGTTGGGTACAACTGG - Intergenic
992392229 5:76339859-76339881 GAATAGGGGCTGGGTAAATGAGG + Intronic
994454218 5:99984480-99984502 GTATAGGGGTTGGGTACAACTGG - Intergenic
994777943 5:104059261-104059283 AAATAGGAGCTGGGTAAAATGGG - Intergenic
995031180 5:107483279-107483301 GATTAGGGCCTGGGTGGATCTGG - Intronic
995583224 5:113621950-113621972 GTATAGGGGTTGGGTATAACTGG + Intergenic
995599890 5:113783984-113784006 AAATAGCCCCTGGGAAAAACTGG - Intergenic
997113604 5:131102030-131102052 GAATAGGGGCTGGGTAAAAAAGG + Intergenic
998111650 5:139507179-139507201 GTATAGGGGTTGGGTACAACTGG - Intergenic
998173904 5:139888617-139888639 CAAGAGGGCCTGGCTAGAACAGG + Intronic
998275055 5:140744544-140744566 GAATGGAGGCTGGGTAAAATAGG - Intergenic
998767683 5:145506507-145506529 GAACATGGCCTGGGTAGCACTGG - Intronic
1001335204 5:170790995-170791017 CAGTAGGGCCTGGGAAAACCAGG - Intronic
1001445549 5:171779902-171779924 GGATAGTGCCTGGCTCAAACTGG - Intergenic
1001654978 5:173342374-173342396 GAACAGGGCCTGTGGAACACAGG + Intergenic
1004531562 6:16459536-16459558 GTATAGGGGTTGGGTACAACCGG - Intronic
1004812433 6:19275076-19275098 GTATAGGGGTTGGGTACAACTGG - Intergenic
1005620342 6:27614324-27614346 GAAGTGGGCTTGGGTAAATCTGG - Intergenic
1007523559 6:42471010-42471032 GTATAGAGGCTGGGTAAAACAGG + Intergenic
1009407523 6:63329378-63329400 GTATAGGGGTTGGGTACAACTGG + Intergenic
1011342614 6:86334055-86334077 GAAGAGGGTCTGGCCAAAACAGG + Intergenic
1012441359 6:99264951-99264973 GTATAGGGGTTGGGTACAACTGG + Intergenic
1013375712 6:109512018-109512040 GAGTAGGGGCTGGGTAAATAAGG + Intronic
1013657088 6:112257131-112257153 GAATAGGGGCTGGGTAAAATAGG + Intergenic
1013907663 6:115237293-115237315 GTATAGGGGTTGGGTACAACTGG + Intergenic
1014533165 6:122584851-122584873 CAATGGGGACTAGGTAAAACAGG + Intronic
1017101140 6:150850902-150850924 GTATAGGGTTTGGGTACAACTGG - Intergenic
1017254050 6:152313373-152313395 GAATAGGGGCTGGGTAAATGAGG - Intronic
1018078557 6:160238917-160238939 GGACAGGGGCTGGGTAAAATGGG + Intronic
1018440880 6:163812104-163812126 GCAAATGGCCTGGATAAAACGGG + Intergenic
1019586096 7:1804524-1804546 GAACAGGGGCTGGGAAAAATGGG - Intergenic
1019845815 7:3499792-3499814 GAATGGGTCCTGGGAAACACAGG + Intronic
1021356407 7:19657171-19657193 GTATAGGGGTTGGGTACAACTGG + Intergenic
1024641199 7:51329999-51330021 GAATAGGGGCTGGGAAAATAAGG - Intergenic
1024765110 7:52648690-52648712 CAATAAGGCCTGGGTACAATGGG - Intergenic
1024870600 7:53958853-53958875 GTATAGGGGTTGGGTACAACTGG + Intergenic
1025223228 7:57134120-57134142 GAATAGGTGCTGGGTAAAATGGG + Intronic
1025634033 7:63305787-63305809 GAATAGGTGCTGGGTAAAATGGG + Intergenic
1025648664 7:63442380-63442402 GAATAGGTGCTGGGTAAAATGGG - Intergenic
1025719485 7:63997127-63997149 GAATAGGTTCTGGGTAAAACAGG - Intergenic
1025742005 7:64205362-64205384 GAATAGGTGCTGGGTAAAATGGG - Intronic
1025746475 7:64247304-64247326 GAATAGGTGCTGGGTGAAATGGG - Intronic
1026118543 7:67516846-67516868 GAATAGGGGCTGGGTAAAATGGG + Intergenic
1028255276 7:88588215-88588237 GAATAAGGCATGTTTAAAACTGG - Intergenic
1029498981 7:100915897-100915919 GAGTAGGGACTGGGTAGAATGGG + Intergenic
1032023865 7:128426027-128426049 GAATGGGGCCCTGGTAGAACCGG + Intergenic
1033161957 7:139005779-139005801 GAATAGAAGCTGGGTAAAATGGG + Intergenic
1033759055 7:144421065-144421087 GTATAGGGGTTGGGTACAACTGG + Intergenic
1033836889 7:145325385-145325407 GAATAGTGCCTGGCAAAACCAGG - Intergenic
1034168009 7:149040524-149040546 GAATCGGGCGTGGGAAAACCTGG + Intergenic
1034579792 7:152032420-152032442 GTATAGGGGTTGGGTACAACTGG + Intronic
1037271265 8:17132920-17132942 GATTAGTGCCTTGGTAAAAGAGG + Intergenic
1037614610 8:20507491-20507513 GAATAGGGGCTGGGAAAATAAGG + Intergenic
1038125800 8:24671480-24671502 GAATAGGGGCTGGGTAAATGAGG + Intergenic
1038638971 8:29308827-29308849 GTATAGGGGTTGGGTACAACTGG - Intergenic
1039662689 8:39484103-39484125 GAAAAGGGCCTTTCTAAAACTGG + Intergenic
1039999503 8:42564297-42564319 GTATAGGGGTTGGGTACAACTGG + Intergenic
1040667692 8:49653156-49653178 GTATAGGGGTTGGGTACAACTGG + Intergenic
1040964881 8:53073237-53073259 GTATAGGGGTTGGGTACAACTGG + Intergenic
1041077304 8:54180328-54180350 GGAGAGGTCATGGGTAAAACAGG + Intergenic
1042145065 8:65719590-65719612 GAATAAGATCTGGGTAATACTGG - Intronic
1042877860 8:73456302-73456324 AAATAGGGCCTCTTTAAAACAGG + Intronic
1043257236 8:78151426-78151448 GTATAGGGGTTGGGTACAACTGG - Intergenic
1043912049 8:85874866-85874888 GAATAGTGACTGGGGAAACCAGG - Intergenic
1044456454 8:92397031-92397053 GTATAGGGGTTGGGTACAACTGG + Intergenic
1050869712 9:10551531-10551553 GAATTGTGCCTTTGTAAAACAGG + Intronic
1051467580 9:17397680-17397702 GAATAGGTGCTGGGTAAAATAGG - Intronic
1051859595 9:21609346-21609368 CAATAGGGGCTGGGTAAAATGGG + Intergenic
1051935448 9:22438402-22438424 GTATAGGGGTTGGGTACAACTGG - Intergenic
1052057597 9:23922015-23922037 GTATAGGGGTTGGGTACAACTGG + Intergenic
1052289681 9:26827215-26827237 GTATAGGGGTTGGGTACAACTGG - Intergenic
1052427479 9:28324388-28324410 GAATAAGGGCTGGTTAAAATGGG + Intronic
1052663929 9:31470308-31470330 AAATAGGAGCTGGGTAAAATGGG - Intergenic
1055966705 9:81872629-81872651 GAATGAGACCTGGGGAAAACTGG - Intergenic
1056392601 9:86153422-86153444 GTATAGGGGATGGGTACAACTGG + Intergenic
1060982061 9:127798659-127798681 GAATAGGGCCCTGGTTAAAAAGG + Intronic
1188136695 X:26501327-26501349 GTATAGGGGTTGGGTACAACTGG - Intergenic
1189953801 X:46258306-46258328 GAATACGGGCTGGGTAAATAAGG + Intergenic
1190828648 X:54041682-54041704 GAATAGATGCTGGGTAAAACAGG - Intronic
1192482578 X:71498351-71498373 GTATAGGGGTTGGGTACAACTGG + Intronic
1194601125 X:95923102-95923124 GATTAGTGCCTGTGTAAAAAAGG - Intergenic
1194871524 X:99138467-99138489 AATTAGGGCCAGGGTAAAAGAGG - Intergenic
1195439748 X:104886611-104886633 GTATAGGGGTTGGGTACAACTGG - Intronic
1196127177 X:112112938-112112960 GTATAGGGGTTGGGTACAACTGG + Intergenic
1196373034 X:115000068-115000090 GAATAGGGACTGGGAAAAATAGG + Intergenic
1199832228 X:151558359-151558381 GTATAGGGATTGGGTACAACTGG + Intergenic
1199948480 X:152686449-152686471 GAACAGGGTCTGGGTAAAATAGG + Intergenic
1199961199 X:152782007-152782029 GAACAGGGTCTGGGTAAAATAGG - Intergenic
1200800850 Y:7386033-7386055 GTATAGGGGTTGGGTATAACTGG + Intergenic
1201455289 Y:14162091-14162113 ATATAGGGGCTGGGTACAACTGG - Intergenic
1201487745 Y:14510176-14510198 GTATAGGGGTTGGGTACAACTGG - Intergenic
1202243052 Y:22790007-22790029 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202258047 Y:22941163-22941185 GTATAGGGGTTGGGTACAACTGG - Intergenic
1202302159 Y:23428216-23428238 GAATAGGGGCTGGGTAAATAAGG - Intergenic
1202396039 Y:24423757-24423779 GTATAGGGTTTGGGTACAACCGG - Intergenic
1202411037 Y:24574921-24574943 GTATAGGGGTTGGGTACAACTGG - Intergenic
1202459744 Y:25095151-25095173 GTATAGGGGTTGGGTACAACTGG + Intergenic
1202474746 Y:25246335-25246357 GTATAGGGTTTGGGTACAACCGG + Intergenic
1202568652 Y:26242382-26242404 GAATAGGGGCTGGGTAAATAAGG + Intergenic