ID: 1164078694

View in Genome Browser
Species Human (GRCh38)
Location 19:21844114-21844136
Sequence CAGTCTGGGCCTAGGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164078694_1164078704 -4 Left 1164078694 19:21844114-21844136 CCTGCGGCCCTAGGCCCAGACTG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1164078704 19:21844133-21844155 ACTGGGGCAGGTGGATCATGAGG 0: 1
1: 29
2: 1169
3: 6553
4: 22560
1164078694_1164078705 28 Left 1164078694 19:21844114-21844136 CCTGCGGCCCTAGGCCCAGACTG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1164078705 19:21844165-21844187 CAAGACCAGCCTGACCAACATGG 0: 10734
1: 66234
2: 131886
3: 161016
4: 155050

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164078694 Original CRISPR CAGTCTGGGCCTAGGGCCGC AGG (reversed) Intronic
900374154 1:2345682-2345704 CAGCCTGGCCCTAGGCCCTCAGG - Intronic
900495141 1:2972791-2972813 CAGTCAGGGCTTGGGGCCCCCGG - Intergenic
901703296 1:11056778-11056800 CAGTCTGGGCCAAGGGGCTGGGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903792727 1:25905990-25906012 CAGTTTGGTCCTAAAGCCGCTGG + Intronic
905819801 1:40980268-40980290 CAGTGCGGGCCTCGGGCCTCCGG + Intronic
907316905 1:53577978-53578000 CAGCCTGGGCCTAGGGTAGGGGG - Intronic
907405605 1:54251761-54251783 CAGGGTGGGCCTAGGGTGGCTGG - Intronic
915363678 1:155301401-155301423 CAGTGTGGGCCTGGGGCTGCGGG + Exonic
915898605 1:159830083-159830105 CAGCCTGGAGCTCGGGCCGCTGG + Exonic
920365584 1:205446700-205446722 CACTGTGGGCCCAGGGCAGCTGG + Intronic
1063148734 10:3318751-3318773 CACCCTGGGCCTGGGGACGCTGG - Intergenic
1069602600 10:69717590-69717612 CAGTCTGGGGCTAGGACCAACGG + Intergenic
1069657657 10:70102065-70102087 CAGTCAGTGCCAAGTGCCGCAGG + Intronic
1070320726 10:75352857-75352879 CTGCCTGGGCCTAGGGCAGAAGG + Intergenic
1075969151 10:126638151-126638173 TAGACTGGGCCTAGGGAGGCAGG - Intronic
1077052853 11:575600-575622 CCGTGTGGGCCTCGGGACGCAGG - Intergenic
1077222979 11:1425585-1425607 CAGCCTGGGCCAGGGGCCACGGG + Intronic
1078726981 11:13940482-13940504 CCGCCTGGGCCCAGGGCAGCGGG + Intergenic
1081705782 11:45181236-45181258 CAGGCAGGGCCTGGGGGCGCTGG - Intronic
1082120020 11:48370146-48370168 CATTCTGGGTCTAGGGTCTCAGG - Intergenic
1083167625 11:60900827-60900849 GAGTCTGGGCCTAGCCCGGCAGG - Intronic
1083654433 11:64222649-64222671 CTGTCTGGGCCTGGGTTCGCCGG + Intronic
1083782707 11:64926300-64926322 CAGTCTGGCCCTATGGCCCAAGG - Intronic
1084510007 11:69597480-69597502 CAGTATGGACCTGGGGCCTCCGG - Intergenic
1084772779 11:71354795-71354817 CAGTCTGGCCCTAGAGCAACAGG - Intergenic
1089515372 11:119028619-119028641 CAGTCTGGGGCTAGTGCCGATGG - Intronic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1091648637 12:2292840-2292862 CAGTGTGGGCCTGGTGCCGCAGG - Intronic
1091665024 12:2412502-2412524 CAGTGTGAGCCTCTGGCCGCGGG - Intronic
1092961209 12:13598336-13598358 CAGTCTGGGCCTGAGGTCGAGGG - Intronic
1096370393 12:51064331-51064353 CAGGCTGGCACTAGAGCCGCTGG + Exonic
1096499150 12:52054912-52054934 CAGGCTGGGGCTGGGGCCGGTGG - Exonic
1097461766 12:59871683-59871705 GAGCCTGGGCCTGGGGCAGCTGG - Intergenic
1101340971 12:103841407-103841429 CAGGCTGGGCGTGGGGCCCCCGG - Intergenic
1102260808 12:111442364-111442386 CAGCCTGGGCCTAGCTCTGCAGG - Intronic
1104038916 12:125116812-125116834 TAGCCTGGGCCCAGGGCTGCAGG - Intronic
1112040352 13:95541022-95541044 CAGTGTGGGCCCTGGGCCACTGG - Intronic
1112533950 13:100231368-100231390 CTGCCTGGGCCTTGGGCTGCAGG + Intronic
1113521511 13:110945453-110945475 CAGGCTAGGACTAGGGCCGCCGG - Intergenic
1113928173 13:113952580-113952602 CAGACTGGGCCTGGGGCAACGGG + Intergenic
1113966916 13:114157993-114158015 CAGCCTGGGTCTAGGGCCCCAGG - Intergenic
1117353470 14:54902525-54902547 CGCTCTTGGCCTCGGGCCGCGGG + Exonic
1121313819 14:92949482-92949504 CAGTGAGGGCCTTGGGCTGCAGG - Intronic
1122599387 14:102913734-102913756 CAGTCTAGGCCTAGGGAAGGAGG + Intergenic
1123971311 15:25510414-25510436 CAGTCTGGTCCTATGACCCCAGG - Intergenic
1128475532 15:67994036-67994058 CAGCCTGGGTGTAGGGCAGCAGG + Intergenic
1129424534 15:75454402-75454424 CAGTCTGGGCCGAGGAGTGCAGG + Intronic
1130655536 15:85789780-85789802 CAGGCTGGGCTTAGGGGAGCAGG - Intronic
1132569449 16:637692-637714 CAGTCTGGGACTGGGAACGCGGG + Intronic
1132670785 16:1101555-1101577 CAGGCTGGGACTGGGGCAGCAGG + Intergenic
1133060343 16:3170784-3170806 CAGGCGGGGCCTTGGGCCCCGGG - Intergenic
1133080387 16:3314456-3314478 CAGTGTGGGTCTTGGGCAGCAGG - Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1139434817 16:66930305-66930327 CAATCTGGGCATAGGGCCAAGGG + Intergenic
1139505602 16:67396679-67396701 CAGCCTGGGCCGAGGAGCGCGGG + Intronic
1140484453 16:75282725-75282747 CAGCCTGGGCCTAAGGGCCCAGG + Intergenic
1140975726 16:80058318-80058340 CAGTCTTGGCGTAGAGCCTCCGG + Intergenic
1141128308 16:81416933-81416955 CAGTGTGGTCCTCGGGCCGGCGG + Intergenic
1142550153 17:733043-733065 CAGTCCGGTCCGAGGACCGCAGG - Intronic
1142795585 17:2304182-2304204 CAGGCCCGGCCTAGCGCCGCGGG + Intronic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1149446336 17:56716116-56716138 TAGTCTGGTCCTAGGGAGGCTGG + Intergenic
1151743674 17:76000673-76000695 AATTCTGGGCCTGGGGCCTCAGG + Intronic
1153280787 18:3412100-3412122 CAGCCTTCGCCGAGGGCCGCAGG + Intronic
1154003320 18:10505575-10505597 CAAACTGGGCCGAAGGCCGCAGG - Intergenic
1157350012 18:46875791-46875813 CAGTCTGGGCCTCTGGCCTGCGG - Intronic
1160631165 18:80247236-80247258 GAGACTGGGCGCAGGGCCGCCGG + Intronic
1162343378 19:10105768-10105790 CAGTCTTGGCCTCAGGCCTCTGG - Intergenic
1162782807 19:13015400-13015422 CAGGCTGGGCCTAGGGTCCTGGG - Intronic
1163175935 19:15564093-15564115 CTGGCTGGGCCTCGGGCCGGTGG + Intergenic
1163426655 19:17244296-17244318 CACTCTGGGCCTTGGGTCACCGG - Intronic
1164078694 19:21844114-21844136 CAGTCTGGGCCTAGGGCCGCAGG - Intronic
1164616218 19:29668238-29668260 CAGTGTGGCCCCAGGGCTGCTGG - Intronic
1165094376 19:33402460-33402482 CAGTCGGCGGCTAGGGCCTCTGG + Intronic
1167441599 19:49512575-49512597 CAGGCTGGGCCTAGGGCCTGGGG + Exonic
1168058221 19:53875386-53875408 CAGGCGGGGCCTAGGGACCCAGG - Exonic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
927137996 2:20111434-20111456 GAGGCTGGGCCTAGGCCCCCTGG - Intergenic
927256327 2:21043772-21043794 CAGCCTGGGCCTAGGCCAGAGGG - Intronic
927496481 2:23554929-23554951 CAGTCTGGGCCTGGGGCACCAGG + Intronic
929438539 2:41947773-41947795 CAGTCTGGGGTGAGGGCCACGGG - Intronic
931516254 2:63052090-63052112 CAGTCTGGGCTGCGGACCGCAGG - Intronic
934043355 2:88148036-88148058 CAGTCTGGTCCTTGGACCCCTGG - Intergenic
938291408 2:130152726-130152748 CAGGCTGAGCCTGGGGCCGCGGG + Exonic
938465135 2:131520233-131520255 CAGGCTGAGCCTGGGGCCGCGGG - Intergenic
942371159 2:175286804-175286826 CAGTCTGGGACAAGGGCTGAGGG - Intergenic
942527768 2:176873600-176873622 CAGTCTGGGACCTGGGCAGCAGG + Intergenic
943820512 2:192315124-192315146 CTCTCTGGGCCTAGGCCAGCAGG + Intergenic
944061991 2:195579434-195579456 CAGGCTGGGCCCAGGGGCTCAGG - Intronic
946748606 2:222870549-222870571 CAGGCTGGGGCTAGGGCCAGTGG + Intronic
947748341 2:232520703-232520725 CAGGCTGGCCCGAGAGCCGCGGG + Intronic
948918182 2:241048840-241048862 CAGTCTGGACCTACGGACCCCGG - Intronic
1169080632 20:2796126-2796148 TGGGCTGGGCCGAGGGCCGCTGG - Exonic
1171034673 20:21705721-21705743 CACCCTGGGCCTGGGGTCGCGGG + Exonic
1171295668 20:24014684-24014706 CACTCTGATCCTAGGGCCGCTGG - Intergenic
1172482614 20:35279836-35279858 CAGTTTGGGACTGGGGCTGCAGG - Intronic
1172666795 20:36605876-36605898 GAGTCGGGGTCTAGGGTCGCAGG - Exonic
1173165996 20:40687807-40687829 TAGTCTGGGACTAGGGACGTGGG + Exonic
1175292451 20:57885277-57885299 CAGGCTGGGACCAGGGTCGCAGG - Intergenic
1176597373 21:8759356-8759378 GACTCTGGGCCTAGGGCCACTGG - Intergenic
1176707061 21:10124935-10124957 CAGGGTGCGCCTCGGGCCGCTGG + Intergenic
1178366200 21:31990965-31990987 CAGTCTCTGCCCAGGGCAGCAGG + Intronic
1179361549 21:40714124-40714146 AAGTCTCTGCCCAGGGCCGCAGG - Intronic
1179639056 21:42735229-42735251 CACTCTGGACCTAGGTCCCCCGG + Intronic
1180076755 21:45467084-45467106 CAGTCTGGGCCAGGGGCAGAGGG - Intronic
1183018139 22:35006678-35006700 CAGCCTGGCCCTTGGGCTGCCGG + Intergenic
1185280355 22:49967223-49967245 GCGGCTGGGCCTAGGGCCCCAGG - Intergenic
1185298778 22:50068245-50068267 CAGCCTGGCCCCAGGGCCTCGGG - Intronic
950656013 3:14436808-14436830 CAGTCAGTGCCAAGGGCCACAGG - Intronic
953618209 3:44510706-44510728 CTCCCTGGGCCCAGGGCCGCTGG + Intergenic
954388981 3:50259145-50259167 GAGCCTGGGGCCAGGGCCGCTGG - Exonic
955246369 3:57228131-57228153 TCGGCTGGGCCGAGGGCCGCAGG + Intronic
960948439 3:122982832-122982854 CACTCTGGCCCTAGGCCCGAGGG - Intronic
963082864 3:141410478-141410500 CAGACTGGGCCTAGGACAGTGGG - Intronic
965813550 3:172614913-172614935 CAGTCTGGGGCAAGGGCTCCAGG + Intergenic
967825015 3:193870612-193870634 CAGCCTGGGCCCCGGGCCTCAGG + Intergenic
968107655 3:196013958-196013980 CAGTGTGGCCCCAGGGCCTCGGG + Intergenic
968812406 4:2805912-2805934 CTGTCTGTGCCAAGGGCCGCGGG + Intronic
969126269 4:4950680-4950702 AAGTGTGGGCCTAGGACCGCTGG + Intergenic
969435673 4:7187938-7187960 CAGCCTGGGCCTGCAGCCGCAGG + Intergenic
969462547 4:7336386-7336408 CAGCCGGGGCCAAGGGCCTCCGG - Intronic
969604176 4:8194071-8194093 CAGCCTGGGGCTCGGGCCTCAGG + Intronic
986125039 5:4876713-4876735 CAGTGTGTCCCTAAGGCCGCGGG + Intergenic
997207712 5:132059767-132059789 CAGACTGGGCCTCAGGCTGCTGG - Intergenic
997265197 5:132491063-132491085 CAGGCTGGGGCCAGGGGCGCTGG - Intergenic
997635007 5:135398658-135398680 CAGTCTGGGCCTGGGCACCCGGG - Intronic
999755718 5:154663030-154663052 CAGTCTGGGGCTGGGGGCGGTGG - Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1002377021 5:178796104-178796126 CAGGCTGGGCCCAGGGCTGCAGG + Intergenic
1003084974 6:3053733-3053755 CAGCCTGGGACCAGGCCCGCGGG + Intergenic
1004020199 6:11770249-11770271 CAGTCTGGGGCTAGGGCCTAGGG + Intronic
1006162631 6:32047155-32047177 CAGTCTGGGCCTGGGTCCCTGGG - Intronic
1007097025 6:39219616-39219638 GAGTCTGGGCCTGGGGCACCTGG + Intronic
1007397225 6:41584894-41584916 GAGTCTGGCCCCAGGGCAGCTGG + Intronic
1007635075 6:43294859-43294881 GAGGATGGGGCTAGGGCCGCTGG - Intergenic
1007769736 6:44183261-44183283 CAGCCTAGGCCAGGGGCCGCGGG + Intronic
1013386590 6:109637944-109637966 CAGTCTGGGATTTGGGCCTCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018848955 6:167574075-167574097 GAGTCTGGGGCTAGGACCGGGGG - Intergenic
1019539183 7:1544148-1544170 CAGGCTGGGCCCAGAGCCGCAGG - Exonic
1019854569 7:3591672-3591694 CACTGTGGGCCCATGGCCGCTGG + Intronic
1020230506 7:6314809-6314831 AACTCTGGACCTATGGCCGCTGG + Intergenic
1023436269 7:40143532-40143554 CAGTCTGGGCCTCTGGCCTGCGG + Intronic
1023937211 7:44748692-44748714 CAGGGTGGGGCCAGGGCCGCAGG - Intronic
1025999757 7:66551705-66551727 GAGTCAGGGCCTAGGGTCTCAGG - Intergenic
1026902823 7:74046438-74046460 CAGCCTGTGCCAAGGGCTGCAGG + Intronic
1027911805 7:84260888-84260910 CAGTCTGGGCCTCAGGCTTCAGG - Intronic
1029494895 7:100891244-100891266 TAGTCTGGACCTGCGGCCGCTGG - Exonic
1032410444 7:131690315-131690337 CCCTCTGGCCCTAGGGCAGCAGG + Intergenic
1033087118 7:138352912-138352934 CAGCATGGGGCTAGAGCCGCTGG - Intergenic
1034427797 7:151023790-151023812 CAGGCTGGGCCTCTGGCAGCGGG - Intronic
1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG + Intronic
1037817698 8:22120637-22120659 CTGTCTGGGCCTAGGGACCAAGG + Intronic
1047873060 8:129106373-129106395 AAGCCTGGGCCTGGAGCCGCTGG - Intergenic
1049698242 8:143994077-143994099 GCCTCTGGGCCTAGAGCCGCGGG - Intronic
1053644363 9:40112090-40112112 CAGGGTGCGCCTTGGGCCGCTGG + Intergenic
1053761795 9:41353397-41353419 CAGGGTGCGCCTCGGGCCGCTGG - Intergenic
1054325212 9:63709333-63709355 CAGGGTGCGCCTCGGGCCGCTGG + Intergenic
1054350655 9:64015314-64015336 CAGGGTGCGCCTCGGGCCGCTGG - Intergenic
1054540388 9:66264517-66264539 CAGGGTGCGCCTCGGGCCGCTGG - Intergenic
1054731268 9:68705002-68705024 CAGTCTGGGCCAGCGGCGGCGGG + Intergenic
1057978906 9:99638092-99638114 CAGTTTGGGCCTAGAGCCAAAGG - Intergenic
1062361614 9:136190920-136190942 GAGTCTTGGCCCAGGGCAGCAGG - Intergenic
1062369411 9:136229950-136229972 CAGTCTGGGCCCAGGCCAGGTGG + Intronic
1062402634 9:136379150-136379172 CAGTCTTGGGCTTGGGCCGGGGG + Exonic
1062498139 9:136841220-136841242 CAGCCTGGGCCCGGGGCAGCGGG - Intronic
1062560609 9:137139981-137140003 CAGTCAGGGCCTGGAGCCCCAGG - Intronic
1202791806 9_KI270719v1_random:93808-93830 CAGGGTGCGCCTCGGGCCGCTGG + Intergenic
1187709533 X:22039745-22039767 CAGTCTGGACCTAAGCCTGCTGG + Intronic
1189208406 X:39261934-39261956 CAGTCTGGGCCTTAGGCCAGAGG + Intergenic
1189269360 X:39740119-39740141 AGGTCTGGGCCCAGGGCCCCGGG + Intergenic
1190339766 X:49286967-49286989 GAGTCTGGGTCAAGGGCCCCCGG - Exonic
1190651290 X:52571237-52571259 CAGTCTGGAGCTGGGGCTGCAGG + Intergenic
1192795307 X:74420933-74420955 CAGCCTGGGCCTCGGACAGCGGG - Intergenic
1195906741 X:109851658-109851680 CAGACTAGGCCTAGAGCCACTGG - Intergenic
1197534742 X:127673752-127673774 CAGTCTGCACCTATGGCCTCAGG + Intergenic
1200088645 X:153624248-153624270 CAGTCAAGCCCCAGGGCCGCTGG + Intergenic
1200771094 Y:7126155-7126177 CAGTCTGTGCCGAGGCCCCCAGG + Intergenic
1201539518 Y:15090993-15091015 CAGTCTGGGACTGGGGCTGCAGG + Intergenic