ID: 1164078990

View in Genome Browser
Species Human (GRCh38)
Location 19:21846406-21846428
Sequence CTTTTCTGTTAGCACAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164078989_1164078990 -4 Left 1164078989 19:21846387-21846409 CCAAACAATAAGTCACTCTCTTT 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG 0: 1
1: 0
2: 2
3: 11
4: 136
1164078985_1164078990 30 Left 1164078985 19:21846353-21846375 CCAAGCATAAGAATCACATCACC 0: 1
1: 0
2: 19
3: 60
4: 366
Right 1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG 0: 1
1: 0
2: 2
3: 11
4: 136
1164078988_1164078990 9 Left 1164078988 19:21846374-21846396 CCTGTGTGCTGGGCCAAACAATA 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG 0: 1
1: 0
2: 2
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164078990 Original CRISPR CTTTTCTGTTAGCACAACCC AGG Intronic
908940360 1:69424997-69425019 CTTTTATGTCAGGAGAACCCTGG - Intergenic
909149967 1:71989108-71989130 CTTCTCTTTTAGCACCAACCCGG - Intronic
910456632 1:87404370-87404392 CTTTTCTGTTACCAGAACAAAGG + Intergenic
912811852 1:112801000-112801022 CTTTTCACTCAGCTCAACCCAGG - Intergenic
913063219 1:115226590-115226612 CTTTTCTGGCGGCACAACTCTGG + Intergenic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
920675665 1:208037089-208037111 CTTATCTGTAAGTACAATCCTGG + Intronic
922979419 1:229813067-229813089 CTTTTCTGTTTACACAGCCATGG + Intergenic
1063599449 10:7467029-7467051 GGTATCTGTTAGCCCAACCCAGG + Intergenic
1067656235 10:48193879-48193901 TTTTTCAGTAAGCACAGCCCTGG - Intronic
1069755894 10:70774353-70774375 TTTTTCTGAAAGCACAGCCCGGG + Exonic
1074215571 10:111380940-111380962 CTTTTCTGTTAACACCAACTTGG - Intergenic
1080718342 11:34825382-34825404 CTTTTCCCTCACCACAACCCCGG + Intergenic
1082139116 11:48586178-48586200 TTTTTCTGATAGAACAACCCAGG + Intergenic
1082624900 11:55471858-55471880 TTTTCCTGATAGAACAACCCAGG + Intergenic
1083038096 11:59658936-59658958 CTTTTTTGTTAGCCCCAACCAGG - Exonic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1086077049 11:82865860-82865882 CTTTTATGTTAGAAGAACACGGG + Intronic
1086578458 11:88368321-88368343 CTTCTCTGTCAGCTAAACCCTGG + Intergenic
1088179758 11:107095613-107095635 CTTTCCTGTTAGCACCGCCTTGG - Intergenic
1094079444 12:26516430-26516452 CTTTTCTGCTATCACAAAGCTGG - Intronic
1095338237 12:41055926-41055948 CTTTTGAGTTTGCACAACCTTGG + Intronic
1097189117 12:57211083-57211105 CTTTTCTGTTTGCATAATCTTGG - Intronic
1097537141 12:60886644-60886666 CTTTCCTCTTAGCACAACCCTGG + Intergenic
1097984231 12:65766580-65766602 CTTTTCTGTTATCAGGACACTGG + Intergenic
1111825425 13:93261734-93261756 CTTATCTGTTTGTCCAACCCTGG - Intronic
1113298767 13:108992695-108992717 CATTTCCATTAGCACAACTCTGG - Intronic
1115060444 14:29182200-29182222 CTTATCTATTAGCACACTCCTGG - Intergenic
1117268840 14:54120223-54120245 CTTTTCTGTTTGAACAGCCAAGG - Intergenic
1117522521 14:56565127-56565149 CATTTCCATTAGCACTACCCTGG + Intronic
1117986755 14:61394215-61394237 CTTGTCTTTTTGCACAAACCTGG + Intronic
1119730978 14:76950999-76951021 CTTTCCTGTTAGCCCAGCCTGGG - Intergenic
1120072054 14:80114803-80114825 TTTTTCTGTTAGATCAACTCTGG + Intergenic
1121933862 14:97998336-97998358 CTATGCTGTTTGCAAAACCCTGG - Intergenic
1125125830 15:36219762-36219784 CTCCTCTGTGAGCACAAGCCAGG + Intergenic
1127191851 15:56539598-56539620 TTTTTCTGTGAGGAGAACCCAGG - Intergenic
1130045745 15:80443333-80443355 CTTTCCTCTTAGCCCAAACCTGG - Intronic
1130108926 15:80949235-80949257 CTTTGCTGTCAGCACAACCCAGG - Exonic
1131236164 15:90698836-90698858 CTTTTCCGTTAGCAGAATCTTGG - Intergenic
1134346709 16:13398234-13398256 CTTGTCTGTGGGCACAAACCCGG + Intergenic
1135496441 16:22955659-22955681 GTTTTCTGTAAGCACAAACCAGG - Intergenic
1135502222 16:23006344-23006366 CTTGTCTATAAGCACCACCCTGG - Intergenic
1135889012 16:26340459-26340481 CTGTTCTGTTTCCACAGCCCAGG - Intergenic
1137321190 16:47384465-47384487 ATTTTCTGCTAGAATAACCCTGG + Intronic
1139214331 16:65112564-65112586 CACTTCTGTTTGCCCAACCCAGG + Intronic
1141753414 16:85975133-85975155 CTTTTCTGCCAGCACCACCCTGG - Intergenic
1141760419 16:86025498-86025520 GTTGTCTCTTAGCACAGCCCCGG + Intergenic
1147610055 17:41796510-41796532 CTTGTCTCTAAGGACAACCCTGG - Intergenic
1149815708 17:59721803-59721825 GTATTCTGTTATGACAACCCTGG - Intronic
1151813124 17:76456799-76456821 CTTGTCTGTTATCACAATCTTGG + Intronic
1153762365 18:8344181-8344203 CTCTTCAGTTAGCACAACCATGG - Intronic
1159135424 18:64331772-64331794 ATTTTCTGGTACCAAAACCCTGG - Intergenic
1161678883 19:5669027-5669049 CTTTAATGTTAGCACAGACCGGG + Intergenic
1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG + Intronic
1164089393 19:21934608-21934630 CTATTCTGTTGGCAGAACACAGG - Intronic
1164128074 19:22336685-22336707 GTTTTCTGTTAGCAAGACCAAGG + Intergenic
1164129425 19:22348503-22348525 CTTTTCTGTTTGCAGATCCCAGG - Intergenic
1164170120 19:22717470-22717492 CTTTTCTGTTTGCAGATCCCAGG + Intergenic
1164171406 19:22728636-22728658 GTTTTCTGTTAGCAGGACCAAGG - Intergenic
1164171994 19:22733559-22733581 CTTTCCTGTGAGCAGAAACCAGG + Intergenic
1164249414 19:23464183-23464205 CTTTTCTATAAGCAAAACCCTGG - Intergenic
1164256226 19:23530580-23530602 CACTTCTGTTAGCATGACCCAGG + Intronic
1164283262 19:23787974-23787996 CGCTTCTGTTAGCATGACCCAGG - Intronic
1165991611 19:39818408-39818430 CTTTCCTGTTTGCTCAATCCAGG + Intergenic
928338250 2:30417525-30417547 CCTTTATGTTACCACGACCCTGG - Intergenic
929974932 2:46623845-46623867 CTTTTTTGTAGGCACAGCCCTGG - Exonic
933800012 2:85953210-85953232 CTCTTCTGTAAGCACATCACTGG - Intergenic
934481475 2:94650252-94650274 TCTTTCTGTGACCACAACCCTGG - Intergenic
935353408 2:102176059-102176081 CTTTTATCTCAGTACAACCCTGG + Intronic
936530783 2:113276037-113276059 GTTTTCTGTGAGCAGAGCCCGGG - Intronic
937012437 2:118574408-118574430 CTTTTATAGTAGCACAGCCCAGG + Intergenic
937750315 2:125469139-125469161 GTTTTCTGGAAACACAACCCAGG - Intergenic
937923113 2:127146247-127146269 CTTTCCTGTGACCACAGCCCCGG - Intergenic
939464574 2:142541025-142541047 CTTTGCTTTTAGCACAGCCATGG + Intergenic
944420955 2:199529725-199529747 CTTTCCTCTTAGCACCACCTTGG - Intergenic
1170346205 20:15389518-15389540 ATTTTCTATTAGCACTCCCCTGG + Intronic
1171265929 20:23772485-23772507 CCTTCCTGTTTGCACAGCCCTGG + Intergenic
1174121290 20:48267706-48267728 CTTTTCTTTTCTCAAAACCCTGG - Intergenic
1174963778 20:55187572-55187594 CTTTTCTTTTAGGACAACAAAGG + Intergenic
1179210002 21:39316294-39316316 CTTATTTGTTGGCACAACCTTGG - Intronic
1182342093 22:29631403-29631425 CTGTTCTGTTAGCACTTACCAGG + Intronic
1184064440 22:42109330-42109352 ATTTTCTATTAGCCCAAACCTGG + Intergenic
952892340 3:38051718-38051740 CTTTTCTAATAGCCAAACCCTGG - Intronic
955672932 3:61420870-61420892 CTCTGCTGTTAGCATGACCCAGG + Intergenic
958443221 3:94181455-94181477 GTTTTCTGTTAGCAATACACGGG - Intergenic
959928498 3:111952923-111952945 ATTTTCTACCAGCACAACCCAGG + Intronic
962554716 3:136536338-136536360 TTTTTCAGTTTGGACAACCCTGG - Intronic
964905391 3:161713230-161713252 CTTTTCTATTACAACAATCCTGG - Intergenic
965503910 3:169490406-169490428 CTTTTCTGTTATCACAAACAGGG - Intronic
969984021 4:11188426-11188448 CTTACCTTTCAGCACAACCCAGG - Intergenic
971794371 4:31207515-31207537 CTTTTTATTCAGCACAACCCAGG + Intergenic
972237256 4:37149003-37149025 CTTTTCTGGTAGGACAGGCCTGG + Intergenic
972840639 4:42926246-42926268 TTTTTCTTTTTGCTCAACCCTGG + Intronic
974468213 4:62285224-62285246 CTATTCTGTTAGCAAAACTGTGG - Intergenic
978576332 4:110194036-110194058 CACTGCTGTTAGCACAAACCTGG + Intronic
979610152 4:122681463-122681485 CTATGCTGTTAGCAGAAGCCAGG - Intergenic
984506373 4:180624150-180624172 CTTTACTATTTGCACAACCTTGG - Intergenic
987414214 5:17646416-17646438 CTTTCCTCTTAGCACCACCTTGG + Intergenic
988098744 5:26651756-26651778 CTTTTTTGTTAGTATAACACAGG + Intergenic
994869084 5:105320839-105320861 CTTTTCTGCAAGCATAACCAGGG + Intergenic
996083107 5:119276658-119276680 CATTTCTCTGTGCACAACCCTGG + Intronic
996520191 5:124417663-124417685 CTTTCCTCTCAGCAAAACCCTGG + Intergenic
997222300 5:132179440-132179462 CTTTCCTGTAAGCAGAAACCAGG - Intergenic
1000370965 5:160536240-160536262 CTTCTCTGCTAGCCCAACCCGGG - Intergenic
1001216052 5:169856801-169856823 CTTTTCTGTCAGCATAACCAGGG + Intronic
1001581281 5:172800216-172800238 CTTTCCCGTTAGCTCAGCCCGGG - Intergenic
1010314468 6:74430380-74430402 CTTTTCTGTTAGCCCATCTAGGG - Intergenic
1012859188 6:104538990-104539012 CTTATCTGATACCACAACCAGGG + Intergenic
1014536694 6:122622213-122622235 TTTTTGTGTTAGCACAAACTCGG + Intronic
1017745173 6:157440371-157440393 TTTTTCAGTTATCACAATCCCGG - Intronic
1018331353 6:162731012-162731034 CTTCTCTGTCACCATAACCCTGG - Intronic
1019392702 7:798051-798073 CTGTTATGTGAGCACATCCCTGG - Intergenic
1019653877 7:2176945-2176967 CTCTTCTGATTTCACAACCCTGG - Intronic
1020801285 7:12735481-12735503 CTTTACTGTTCACACATCCCTGG + Intergenic
1021011910 7:15479721-15479743 CCTTGCATTTAGCACAACCCTGG - Intronic
1024620505 7:51153191-51153213 CTTTTTTATTAGCACATCACTGG + Intronic
1025785933 7:64643268-64643290 CTCTTCTGTGAGCACCATCCAGG - Intergenic
1031816143 7:126438671-126438693 ATTTATTTTTAGCACAACCCAGG + Exonic
1036803924 8:11814458-11814480 CTTTTCTGTAAACACAGACCAGG + Intronic
1037483351 8:19325491-19325513 CTTTTCTGTTCCCCCAACTCTGG + Intronic
1037493611 8:19418705-19418727 CTTTTCAGTCAGTACAATCCTGG - Exonic
1038520754 8:28230194-28230216 GTTTTCTGTTCTCACAACTCTGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1045971741 8:108086093-108086115 CTTCTCTGTAAACAGAACCCAGG - Intergenic
1047403868 8:124568824-124568846 CTCTTCTGCCAACACAACCCTGG + Intronic
1048944038 8:139428021-139428043 CCTTTCTGTTAACATGACCCAGG + Intergenic
1049641989 8:143719987-143720009 CACTTCTGTGAGCACACCCCAGG + Intronic
1050050691 9:1598028-1598050 CTTTTCTGATGTCAGAACCCTGG - Intergenic
1052091503 9:24334103-24334125 CTTTGCTTTTAGCAAAACTCAGG + Intergenic
1053676360 9:40433855-40433877 TCTTTCTGTGACCACAACCCTGG + Intergenic
1053926134 9:43059971-43059993 TCTTTCTGTGACCACAACCCTGG + Intergenic
1054287359 9:63191038-63191060 TCTTTCTGTGACCACAACCCTGG - Intergenic
1054289427 9:63269380-63269402 TCTTTCTGTGACCACAACCCTGG + Intergenic
1054387460 9:64573926-64573948 TCTTTCTGTGACCACAACCCTGG + Intergenic
1054508262 9:65942439-65942461 TCTTTCTGTGACCACAACCCTGG - Intergenic
1054846486 9:69803897-69803919 CCTTTCTTTTAGCACAACTTTGG + Intergenic
1056106929 9:83355994-83356016 CTTTTGTGTCAGCAAATCCCAGG + Intronic
1056531793 9:87494841-87494863 CTTTTCTCTTAACACATACCAGG - Intergenic
1059150985 9:111949571-111949593 CATTTTTGTTAGCAAAACACTGG + Intergenic
1059604763 9:115822372-115822394 CTTGTCTGTTATCACCACTCTGG + Intergenic
1187046457 X:15651845-15651867 CTTTTCTGTTATTACAGCCCTGG - Intronic
1189173861 X:38934594-38934616 CTATGCTCTTAGCACTACCCTGG - Intergenic
1189842569 X:45096382-45096404 CTTTTCACCTAGCACAAACCTGG - Intronic
1190474831 X:50815531-50815553 CTTTTTTCTTAGCACCCCCCTGG + Intergenic
1192214804 X:69150684-69150706 CTTTCCTGTTTGCACACCTCAGG - Intergenic
1193549892 X:82879053-82879075 CTGTGCTGTTAGCCCAAACCAGG - Intergenic
1194235049 X:91372589-91372611 CTGTTCTGTGAGCCCAAACCAGG - Intergenic
1196291795 X:113950484-113950506 CTATGCTGTTAGTACAACTCAGG - Intergenic
1196891334 X:120293627-120293649 CATTTCTGTTACTACAGCCCTGG - Intronic
1200040343 X:153361108-153361130 TGTTTCTATTAGCAAAACCCTGG - Intergenic