ID: 1164080599

View in Genome Browser
Species Human (GRCh38)
Location 19:21858703-21858725
Sequence TCCTCTGTTTCTACCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164080599_1164080603 9 Left 1164080599 19:21858703-21858725 CCCTTCCTGGTAGAAACAGAGGA No data
Right 1164080603 19:21858735-21858757 TATTCGTGAACTCAAAACCCTGG No data
1164080599_1164080607 28 Left 1164080599 19:21858703-21858725 CCCTTCCTGGTAGAAACAGAGGA No data
Right 1164080607 19:21858754-21858776 CTGGCATTGGTCACAGACTGAGG No data
1164080599_1164080604 15 Left 1164080599 19:21858703-21858725 CCCTTCCTGGTAGAAACAGAGGA No data
Right 1164080604 19:21858741-21858763 TGAACTCAAAACCCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164080599 Original CRISPR TCCTCTGTTTCTACCAGGAA GGG (reversed) Intergenic