ID: 1164080600

View in Genome Browser
Species Human (GRCh38)
Location 19:21858704-21858726
Sequence CTCCTCTGTTTCTACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164080600_1164080607 27 Left 1164080600 19:21858704-21858726 CCTTCCTGGTAGAAACAGAGGAG No data
Right 1164080607 19:21858754-21858776 CTGGCATTGGTCACAGACTGAGG No data
1164080600_1164080603 8 Left 1164080600 19:21858704-21858726 CCTTCCTGGTAGAAACAGAGGAG No data
Right 1164080603 19:21858735-21858757 TATTCGTGAACTCAAAACCCTGG No data
1164080600_1164080604 14 Left 1164080600 19:21858704-21858726 CCTTCCTGGTAGAAACAGAGGAG No data
Right 1164080604 19:21858741-21858763 TGAACTCAAAACCCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164080600 Original CRISPR CTCCTCTGTTTCTACCAGGA AGG (reversed) Intergenic